ID: 1150612834

View in Genome Browser
Species Human (GRCh38)
Location 17:66747926-66747948
Sequence CTGGGCTCCTCTTTCTGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 7, 3: 32, 4: 394}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150612834_1150612839 -8 Left 1150612834 17:66747926-66747948 CCGGGCCAGAAAGAGGAGCCCAG 0: 1
1: 0
2: 7
3: 32
4: 394
Right 1150612839 17:66747941-66747963 GAGCCCAGAGGAGAGCTGGGAGG 0: 1
1: 0
2: 3
3: 63
4: 573
1150612834_1150612845 3 Left 1150612834 17:66747926-66747948 CCGGGCCAGAAAGAGGAGCCCAG 0: 1
1: 0
2: 7
3: 32
4: 394
Right 1150612845 17:66747952-66747974 AGAGCTGGGAGGAGGGCCTTGGG 0: 1
1: 0
2: 4
3: 45
4: 512
1150612834_1150612848 11 Left 1150612834 17:66747926-66747948 CCGGGCCAGAAAGAGGAGCCCAG 0: 1
1: 0
2: 7
3: 32
4: 394
Right 1150612848 17:66747960-66747982 GAGGAGGGCCTTGGGGCTGGAGG 0: 1
1: 0
2: 9
3: 109
4: 944
1150612834_1150612847 8 Left 1150612834 17:66747926-66747948 CCGGGCCAGAAAGAGGAGCCCAG 0: 1
1: 0
2: 7
3: 32
4: 394
Right 1150612847 17:66747957-66747979 TGGGAGGAGGGCCTTGGGGCTGG 0: 1
1: 1
2: 10
3: 114
4: 1057
1150612834_1150612843 -4 Left 1150612834 17:66747926-66747948 CCGGGCCAGAAAGAGGAGCCCAG 0: 1
1: 0
2: 7
3: 32
4: 394
Right 1150612843 17:66747945-66747967 CCAGAGGAGAGCTGGGAGGAGGG 0: 1
1: 0
2: 2
3: 88
4: 767
1150612834_1150612844 2 Left 1150612834 17:66747926-66747948 CCGGGCCAGAAAGAGGAGCCCAG 0: 1
1: 0
2: 7
3: 32
4: 394
Right 1150612844 17:66747951-66747973 GAGAGCTGGGAGGAGGGCCTTGG 0: 1
1: 2
2: 3
3: 103
4: 760
1150612834_1150612846 4 Left 1150612834 17:66747926-66747948 CCGGGCCAGAAAGAGGAGCCCAG 0: 1
1: 0
2: 7
3: 32
4: 394
Right 1150612846 17:66747953-66747975 GAGCTGGGAGGAGGGCCTTGGGG 0: 1
1: 1
2: 4
3: 66
4: 633
1150612834_1150612841 -5 Left 1150612834 17:66747926-66747948 CCGGGCCAGAAAGAGGAGCCCAG 0: 1
1: 0
2: 7
3: 32
4: 394
Right 1150612841 17:66747944-66747966 CCCAGAGGAGAGCTGGGAGGAGG 0: 1
1: 0
2: 7
3: 95
4: 754
1150612834_1150612849 18 Left 1150612834 17:66747926-66747948 CCGGGCCAGAAAGAGGAGCCCAG 0: 1
1: 0
2: 7
3: 32
4: 394
Right 1150612849 17:66747967-66747989 GCCTTGGGGCTGGAGGCAGCTGG 0: 1
1: 2
2: 12
3: 58
4: 723

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150612834 Original CRISPR CTGGGCTCCTCTTTCTGGCC CGG (reversed) Intronic