ID: 1150612836

View in Genome Browser
Species Human (GRCh38)
Location 17:66747931-66747953
Sequence CTCCTCTGGGCTCCTCTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 318}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150612836_1150612843 -9 Left 1150612836 17:66747931-66747953 CCAGAAAGAGGAGCCCAGAGGAG 0: 1
1: 0
2: 2
3: 52
4: 318
Right 1150612843 17:66747945-66747967 CCAGAGGAGAGCTGGGAGGAGGG 0: 1
1: 0
2: 2
3: 88
4: 767
1150612836_1150612845 -2 Left 1150612836 17:66747931-66747953 CCAGAAAGAGGAGCCCAGAGGAG 0: 1
1: 0
2: 2
3: 52
4: 318
Right 1150612845 17:66747952-66747974 AGAGCTGGGAGGAGGGCCTTGGG 0: 1
1: 0
2: 4
3: 45
4: 512
1150612836_1150612849 13 Left 1150612836 17:66747931-66747953 CCAGAAAGAGGAGCCCAGAGGAG 0: 1
1: 0
2: 2
3: 52
4: 318
Right 1150612849 17:66747967-66747989 GCCTTGGGGCTGGAGGCAGCTGG 0: 1
1: 2
2: 12
3: 58
4: 723
1150612836_1150612841 -10 Left 1150612836 17:66747931-66747953 CCAGAAAGAGGAGCCCAGAGGAG 0: 1
1: 0
2: 2
3: 52
4: 318
Right 1150612841 17:66747944-66747966 CCCAGAGGAGAGCTGGGAGGAGG 0: 1
1: 0
2: 7
3: 95
4: 754
1150612836_1150612848 6 Left 1150612836 17:66747931-66747953 CCAGAAAGAGGAGCCCAGAGGAG 0: 1
1: 0
2: 2
3: 52
4: 318
Right 1150612848 17:66747960-66747982 GAGGAGGGCCTTGGGGCTGGAGG 0: 1
1: 0
2: 9
3: 109
4: 944
1150612836_1150612847 3 Left 1150612836 17:66747931-66747953 CCAGAAAGAGGAGCCCAGAGGAG 0: 1
1: 0
2: 2
3: 52
4: 318
Right 1150612847 17:66747957-66747979 TGGGAGGAGGGCCTTGGGGCTGG 0: 1
1: 1
2: 10
3: 114
4: 1057
1150612836_1150612844 -3 Left 1150612836 17:66747931-66747953 CCAGAAAGAGGAGCCCAGAGGAG 0: 1
1: 0
2: 2
3: 52
4: 318
Right 1150612844 17:66747951-66747973 GAGAGCTGGGAGGAGGGCCTTGG 0: 1
1: 2
2: 3
3: 103
4: 760
1150612836_1150612846 -1 Left 1150612836 17:66747931-66747953 CCAGAAAGAGGAGCCCAGAGGAG 0: 1
1: 0
2: 2
3: 52
4: 318
Right 1150612846 17:66747953-66747975 GAGCTGGGAGGAGGGCCTTGGGG 0: 1
1: 1
2: 4
3: 66
4: 633

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150612836 Original CRISPR CTCCTCTGGGCTCCTCTTTC TGG (reversed) Intronic