ID: 1150612839

View in Genome Browser
Species Human (GRCh38)
Location 17:66747941-66747963
Sequence GAGCCCAGAGGAGAGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 640
Summary {0: 1, 1: 0, 2: 3, 3: 63, 4: 573}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150612821_1150612839 27 Left 1150612821 17:66747891-66747913 CCCGAGTGCTGGGCACTGTTCCA 0: 1
1: 1
2: 3
3: 44
4: 369
Right 1150612839 17:66747941-66747963 GAGCCCAGAGGAGAGCTGGGAGG 0: 1
1: 0
2: 3
3: 63
4: 573
1150612820_1150612839 28 Left 1150612820 17:66747890-66747912 CCCCGAGTGCTGGGCACTGTTCC 0: 1
1: 0
2: 2
3: 14
4: 147
Right 1150612839 17:66747941-66747963 GAGCCCAGAGGAGAGCTGGGAGG 0: 1
1: 0
2: 3
3: 63
4: 573
1150612818_1150612839 30 Left 1150612818 17:66747888-66747910 CCCCCCGAGTGCTGGGCACTGTT 0: 1
1: 0
2: 4
3: 31
4: 270
Right 1150612839 17:66747941-66747963 GAGCCCAGAGGAGAGCTGGGAGG 0: 1
1: 0
2: 3
3: 63
4: 573
1150612834_1150612839 -8 Left 1150612834 17:66747926-66747948 CCGGGCCAGAAAGAGGAGCCCAG 0: 1
1: 0
2: 7
3: 32
4: 394
Right 1150612839 17:66747941-66747963 GAGCCCAGAGGAGAGCTGGGAGG 0: 1
1: 0
2: 3
3: 63
4: 573
1150612822_1150612839 26 Left 1150612822 17:66747892-66747914 CCGAGTGCTGGGCACTGTTCCAG 0: 2
1: 0
2: 9
3: 84
4: 459
Right 1150612839 17:66747941-66747963 GAGCCCAGAGGAGAGCTGGGAGG 0: 1
1: 0
2: 3
3: 63
4: 573
1150612832_1150612839 2 Left 1150612832 17:66747916-66747938 CCGGGGGGTGCCGGGCCAGAAAG 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1150612839 17:66747941-66747963 GAGCCCAGAGGAGAGCTGGGAGG 0: 1
1: 0
2: 3
3: 63
4: 573
1150612831_1150612839 7 Left 1150612831 17:66747911-66747933 CCAGGCCGGGGGGTGCCGGGCCA 0: 1
1: 0
2: 1
3: 22
4: 327
Right 1150612839 17:66747941-66747963 GAGCCCAGAGGAGAGCTGGGAGG 0: 1
1: 0
2: 3
3: 63
4: 573
1150612819_1150612839 29 Left 1150612819 17:66747889-66747911 CCCCCGAGTGCTGGGCACTGTTC 0: 1
1: 0
2: 4
3: 23
4: 234
Right 1150612839 17:66747941-66747963 GAGCCCAGAGGAGAGCTGGGAGG 0: 1
1: 0
2: 3
3: 63
4: 573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150612839 Original CRISPR GAGCCCAGAGGAGAGCTGGG AGG Intronic