ID: 1150612841

View in Genome Browser
Species Human (GRCh38)
Location 17:66747944-66747966
Sequence CCCAGAGGAGAGCTGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 857
Summary {0: 1, 1: 0, 2: 7, 3: 95, 4: 754}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150612831_1150612841 10 Left 1150612831 17:66747911-66747933 CCAGGCCGGGGGGTGCCGGGCCA 0: 1
1: 0
2: 1
3: 22
4: 327
Right 1150612841 17:66747944-66747966 CCCAGAGGAGAGCTGGGAGGAGG 0: 1
1: 0
2: 7
3: 95
4: 754
1150612834_1150612841 -5 Left 1150612834 17:66747926-66747948 CCGGGCCAGAAAGAGGAGCCCAG 0: 1
1: 0
2: 7
3: 32
4: 394
Right 1150612841 17:66747944-66747966 CCCAGAGGAGAGCTGGGAGGAGG 0: 1
1: 0
2: 7
3: 95
4: 754
1150612832_1150612841 5 Left 1150612832 17:66747916-66747938 CCGGGGGGTGCCGGGCCAGAAAG 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1150612841 17:66747944-66747966 CCCAGAGGAGAGCTGGGAGGAGG 0: 1
1: 0
2: 7
3: 95
4: 754
1150612821_1150612841 30 Left 1150612821 17:66747891-66747913 CCCGAGTGCTGGGCACTGTTCCA 0: 1
1: 1
2: 3
3: 44
4: 369
Right 1150612841 17:66747944-66747966 CCCAGAGGAGAGCTGGGAGGAGG 0: 1
1: 0
2: 7
3: 95
4: 754
1150612836_1150612841 -10 Left 1150612836 17:66747931-66747953 CCAGAAAGAGGAGCCCAGAGGAG 0: 1
1: 0
2: 2
3: 52
4: 318
Right 1150612841 17:66747944-66747966 CCCAGAGGAGAGCTGGGAGGAGG 0: 1
1: 0
2: 7
3: 95
4: 754
1150612822_1150612841 29 Left 1150612822 17:66747892-66747914 CCGAGTGCTGGGCACTGTTCCAG 0: 2
1: 0
2: 9
3: 84
4: 459
Right 1150612841 17:66747944-66747966 CCCAGAGGAGAGCTGGGAGGAGG 0: 1
1: 0
2: 7
3: 95
4: 754

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150612841 Original CRISPR CCCAGAGGAGAGCTGGGAGG AGG Intronic