ID: 1150615450

View in Genome Browser
Species Human (GRCh38)
Location 17:66767349-66767371
Sequence CTGCTGGTACGGAGTGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150615446_1150615450 23 Left 1150615446 17:66767303-66767325 CCTGCTGTATGTTGTTTTGCTTA 0: 4
1: 9
2: 19
3: 63
4: 518
Right 1150615450 17:66767349-66767371 CTGCTGGTACGGAGTGAAGACGG 0: 1
1: 0
2: 0
3: 9
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150615450 Original CRISPR CTGCTGGTACGGAGTGAAGA CGG Intronic
902297814 1:15480555-15480577 CTGCTGCCACCGTGTGAAGAAGG - Intronic
902700190 1:18167169-18167191 CTGCTGGCACGGATCGCAGAGGG + Intronic
902731666 1:18373922-18373944 CTGCTGGTTCTAAGGGAAGAAGG - Intronic
904213307 1:28899878-28899900 CAGCTGGTAAGGGGTGAAGCTGG - Intronic
904473838 1:30751929-30751951 CTGCTGGTAAGTAATGGAGATGG + Intronic
906290702 1:44617672-44617694 CTGATGGTGAGGAGTGGAGAGGG - Intronic
907032175 1:51183354-51183376 CTGCTGGGACCTAGGGAAGAAGG + Intergenic
909358997 1:74740985-74741007 CTGCTGGATAGGGGTGAAGAAGG + Intronic
910396866 1:86802386-86802408 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
913167263 1:116199774-116199796 CTGCTTGTACTGAGAGAAGCAGG - Intergenic
913713825 1:121513552-121513574 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
914277162 1:146135392-146135414 CGGCTCATACGGAGTGAGGAGGG + Exonic
914538971 1:148592637-148592659 CGGCTCATACGGAGTGAGGAGGG + Exonic
916633040 1:166637761-166637783 CTGCTCTTACTGAGAGAAGAAGG + Intergenic
920144274 1:203844710-203844732 CAGCTTGTATGGACTGAAGATGG + Intronic
920146082 1:203861950-203861972 CTTCAGGTGCGGAGTGAAAACGG + Intronic
923326995 1:232888774-232888796 CTGCAGGTAAGGAGTGAACAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1063584163 10:7336071-7336093 CTGTTGGAACTGAGTTAAGATGG - Intronic
1065083019 10:22145815-22145837 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1067942735 10:50669906-50669928 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1068142515 10:53025956-53025978 CTGCTGGTTAGGGGTGAAGAAGG + Intergenic
1068404602 10:56573410-56573432 CTGCTGGAAAGGGGTCAAGAAGG + Intergenic
1069498912 10:68931851-68931873 CTGCTGGAACAGACTGAAAAGGG - Intronic
1069512392 10:69052206-69052228 CTGCTGGTCTGGAGTGGGGAAGG + Intergenic
1069947281 10:71996657-71996679 CTGCTGGTTCTGGGGGAAGAAGG + Intronic
1070863977 10:79694869-79694891 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1071630876 10:87217095-87217117 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1072370756 10:94764592-94764614 CTGCTGGAGAGGGGTGAAGAAGG + Intronic
1073971317 10:109047742-109047764 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1074613374 10:115042046-115042068 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1075055438 10:119214988-119215010 CTGCAGTTCTGGAGTGAAGACGG + Intronic
1075456588 10:122588901-122588923 CTGCTGATAGGGATTGATGAAGG + Intronic
1076138557 10:128062148-128062170 CTGGTGGAACGGAGTGATGCTGG - Intronic
1079329581 11:19522498-19522520 CGGCTGGTGAGGAGGGAAGAAGG - Intronic
1084300862 11:68251148-68251170 CTGCTGCTGCCAAGTGAAGAAGG + Intergenic
1086112675 11:83216928-83216950 CTGCTGGTTAGGGGCGAAGAAGG + Intronic
1086443423 11:86850329-86850351 CTGCTGGTTAGGGATGAAGAAGG - Intronic
1086696867 11:89857787-89857809 CTCCTGGTACGGACTGACCATGG + Intergenic
1086709291 11:89986701-89986723 CTCCTGGTACGGACTGACCATGG - Intergenic
1087458668 11:98420065-98420087 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
1088540760 11:110911273-110911295 CTGCTGGTGCAGAGGGGAGAGGG + Intergenic
1089069553 11:115688933-115688955 CTGCTGAAATGGACTGAAGAAGG + Intergenic
1089321250 11:117628156-117628178 CTGCTGGGTCGATGTGAAGAGGG + Intronic
1090900533 11:131026943-131026965 CTCCTGGGATGGAGTGAAGTGGG + Intergenic
1092653641 12:10661714-10661736 CAGCTAGTAAGCAGTGAAGATGG + Intronic
1098243256 12:68489064-68489086 CTGGTGGGAGGGAGTGAAGGGGG - Intergenic
1099414456 12:82370114-82370136 CTGCTGGATAGGGGTGAAGAAGG + Intronic
1100210477 12:92393661-92393683 CTGCTGGATGGGTGTGAAGAAGG - Intergenic
1102364751 12:112322663-112322685 CTGCTGGTATGAATTCAAGATGG + Intronic
1103330862 12:120153213-120153235 CTGCTGGGAGGGGGTGGAGAGGG + Exonic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1114039815 14:18667328-18667350 CTGTTGGTAAGCAGTCAAGATGG - Intergenic
1114044856 14:18865878-18865900 CTGTTGGTAAGCAGTCAAGATGG - Intergenic
1114119367 14:19653644-19653666 CTGTTGGTAAGCAGTCAAGATGG + Intergenic
1114261397 14:21039167-21039189 GTGCTGGGAGGGAGTGAAGGGGG - Intronic
1117632867 14:57711228-57711250 CTGCTGCTACCTTGTGAAGAAGG + Intronic
1124350623 15:28953164-28953186 ACGCTGGTAGGGAGTGATGAGGG - Intronic
1125698450 15:41659537-41659559 CAGCTGGTAAGGAGTAGAGAAGG + Intronic
1127162657 15:56205983-56206005 CTGCTGGTAGGGATGGAAAATGG + Intronic
1127232693 15:57014352-57014374 CTGATGGTAGGGAATGAGGAAGG - Intronic
1137974763 16:53022051-53022073 CTGCTGATTCGTAGTGATGAGGG - Intergenic
1138066348 16:53945391-53945413 CAGCTAGTAAGTAGTGAAGATGG + Intronic
1146151328 17:30475258-30475280 TTGATGGCAAGGAGTGAAGATGG - Intergenic
1148212475 17:45816851-45816873 CAGCTGGTAAGGGGTGAAGCTGG + Intronic
1148731073 17:49836983-49837005 ATGATGGTAAGGTGTGAAGATGG + Intergenic
1149074625 17:52580655-52580677 CTGCTGGATAGGAGTGAAGAAGG - Intergenic
1150615450 17:66767349-66767371 CTGCTGGTACGGAGTGAAGACGG + Intronic
1153197581 18:2617609-2617631 CTTCTGTTTCGGAGTAAAGATGG - Intergenic
1153733698 18:8042951-8042973 CGGTTGAGACGGAGTGAAGAGGG - Intronic
1155767025 18:29648852-29648874 CTGCTGCTACCTTGTGAAGAAGG + Intergenic
1158047878 18:53178093-53178115 CTGATTGAACTGAGTGAAGAAGG - Intronic
1158423862 18:57321942-57321964 GTGCTGGTAGGCTGTGAAGATGG + Intergenic
1161511498 19:4674812-4674834 CTGCTGGGACGATGTGAGGAGGG + Intergenic
1163518593 19:17779239-17779261 CTGCTGGAACGGGGTGATCACGG + Intronic
1164588751 19:29494674-29494696 CGGGTGGTAAGGAGGGAAGAAGG + Intergenic
1168243049 19:55096737-55096759 CTGCGGGGAAGGTGTGAAGACGG - Intronic
1168243123 19:55097049-55097071 CTGCGGGGAAGGGGTGAAGACGG - Intronic
1168243147 19:55097150-55097172 CTGCAGGGAAGGGGTGAAGACGG - Intronic
1168243182 19:55097315-55097337 CTGCAGGGAAGGGGTGAAGACGG - Intronic
1168243196 19:55097372-55097394 CTGCAGGGAAGGGGTGAAGACGG - Intronic
1168243203 19:55097402-55097424 CTGCGGGGAAGGGGTGAAGACGG - Intronic
1168243255 19:55097631-55097653 CTGCGGGGAAGGGGTGAAGACGG - Intronic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
1168655621 19:58125513-58125535 ATGGAGGCACGGAGTGAAGAAGG - Intergenic
925428289 2:3769439-3769461 CTGATGGAATGGAGTGAAGACGG - Intronic
925501759 2:4512747-4512769 CAGCTGGAATGGAGTGAAGGAGG - Intergenic
925594906 2:5545258-5545280 CTGCTGTCACCTAGTGAAGAAGG + Intergenic
925949258 2:8895699-8895721 CTGCTGGATAGGAGCGAAGAAGG + Intronic
930095421 2:47562696-47562718 GTGCTGGTAGAGAATGAAGAAGG - Intronic
931478434 2:62614777-62614799 CTTCTGGTACAGAGTGAATTGGG - Intergenic
935684422 2:105670970-105670992 CTCCTGGTGGGGAGTGGAGAGGG - Intergenic
937050481 2:118884241-118884263 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
938270736 2:129968279-129968301 CTGTTGGTAAGCAGTCAAGATGG + Intergenic
939852549 2:147318620-147318642 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
942484079 2:176421201-176421223 CTGCTGGAACGGAATGATGAAGG + Intergenic
943102734 2:183507972-183507994 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
943134339 2:183892271-183892293 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
947708125 2:232292869-232292891 GTCCTGGTATTGAGTGAAGAGGG - Intronic
948041647 2:234905999-234906021 CTGCTGCTAGGGAGGGAAGCAGG - Intergenic
1171978025 20:31607656-31607678 CTGCGGGTCTGGAGTGAAGGTGG + Intergenic
1172340991 20:34157444-34157466 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1175386761 20:58601327-58601349 CTGCTGGTAGGAATTGAAAATGG - Intergenic
1177136058 21:17306381-17306403 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1180463379 22:15588438-15588460 CTGTTGGTAAGCAGTCAAGATGG - Intergenic
1180978613 22:19867591-19867613 CTGCTGGTAAGGAGTGATCTTGG + Intergenic
1182817420 22:33177963-33177985 CTGCTGCTACCTTGTGAAGAAGG + Intronic
1183109230 22:35636825-35636847 CAGCTGGGAGGGAGGGAAGAGGG - Intronic
1184476575 22:44725270-44725292 CTGCAGGTACTCCGTGAAGAAGG - Exonic
952366808 3:32682144-32682166 CTGCTGATACGGAAAGTAGAGGG + Intergenic
952453604 3:33453186-33453208 CTGCTGGATAGAAGTGAAGAAGG - Intergenic
954231530 3:49221578-49221600 CTGCTGGTTAGGGGCGAAGAAGG + Intronic
954599389 3:51856154-51856176 CTGCTGGACAGGGGTGAAGAAGG - Intergenic
955480154 3:59381736-59381758 CTGCTGGTACACAGTGAAGCTGG + Intergenic
956842481 3:73153490-73153512 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
957916295 3:86692317-86692339 CTGCTGGTTAGGGGCGAAGAAGG + Intergenic
960064069 3:113351980-113352002 CTGCTGGGTAGGGGTGAAGAAGG - Intronic
961232862 3:125334847-125334869 CTGCTGGAGTGGAGTGAACAAGG - Intronic
961453977 3:127015315-127015337 CTCCTGGTACGGGGTGCAGGTGG + Exonic
963296012 3:143547602-143547624 TGGCTGGTATGGAGTGAACAAGG - Intronic
963697314 3:148577504-148577526 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
964972565 3:162579507-162579529 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
965727989 3:171739788-171739810 CAGCTGGTAAGTGGTGAAGAAGG + Intronic
966419764 3:179726088-179726110 CAGATGGTAGGGAGTGAGGAAGG + Intronic
967236899 3:187393789-187393811 ATGCTGGTAAGAAGGGAAGAAGG - Intergenic
968245652 3:197144371-197144393 CTGCTGGTTAGGAGTGTAGCTGG - Intronic
968248061 3:197175032-197175054 CTCCTGTTACGAAGTGAGGAGGG + Intronic
968490845 4:889856-889878 CAGCTGGTGAGGAGTGGAGAGGG - Intronic
968527806 4:1072961-1072983 CTGCTGGAACGGAAACAAGACGG + Exonic
971349453 4:25843269-25843291 CTGCTGGTGGGGGGTGAGGAGGG + Intronic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
974527426 4:63061655-63061677 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
974969323 4:68804888-68804910 CTGATGGTTAGGGGTGAAGAAGG - Intergenic
975034955 4:69668759-69668781 CTGCTGCTGTGGAGTGAGGAGGG - Intergenic
975595283 4:76043919-76043941 CTGCTGGATAGGGGTGAAGAAGG + Intronic
977640751 4:99355606-99355628 CTGCTGGATAGGAGCGAAGAAGG - Intergenic
978174461 4:105712405-105712427 TGGCTGGAAGGGAGTGAAGAAGG + Intronic
982761868 4:159294373-159294395 CTGCTGGTACGATCAGAAGATGG - Intronic
986000964 5:3630220-3630242 ATGCTGGGAAGGAATGAAGATGG + Intergenic
988591476 5:32553392-32553414 CTGCTGGATAGGTGTGAAGAAGG + Intronic
991249252 5:64541506-64541528 CTGCTGGTAGGAAGTGAATGTGG - Intronic
995707310 5:114999072-114999094 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
998354795 5:141526021-141526043 ATGCAGGTGAGGAGTGAAGACGG - Exonic
998712963 5:144848102-144848124 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
999343742 5:150796425-150796447 CTGGTGGGAGGGAGTGAAGGGGG - Exonic
1000179489 5:158794208-158794230 CCCCTGGGACAGAGTGAAGAGGG + Intronic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1004532220 6:16464016-16464038 CTGCTGGATAGGGGTGAAGAAGG - Intronic
1004812820 6:19278101-19278123 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1005804873 6:29464898-29464920 CTGCTAAAATGGAGTGAAGAAGG - Intergenic
1006554867 6:34857359-34857381 CTGCAGGAAAGGAGTGTAGATGG - Exonic
1007311710 6:40951931-40951953 GTGCTGGTGGGAAGTGAAGAAGG - Intergenic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1009385079 6:63078027-63078049 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
1009407196 6:63327086-63327108 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
1013581099 6:111535489-111535511 CTGCTAGTAGGTAGTGAAGCTGG - Intergenic
1014778513 6:125537435-125537457 CTGGTGCTGTGGAGTGAAGAAGG - Intergenic
1016989622 6:149920215-149920237 ATGGTGGGACGGAGTGAGGATGG + Intronic
1018123562 6:160660219-160660241 ATGCTGATAGGGAGGGAAGAGGG - Intronic
1018136353 6:160781640-160781662 ATGCTGATAGGGAGGGAAGAGGG + Intergenic
1018492962 6:164315591-164315613 CTGCTGGCATGTAGTGATGAAGG + Intergenic
1019498183 7:1350658-1350680 CTGCTGGTAGGCAGGGAAAAAGG - Intergenic
1021356041 7:19654394-19654416 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
1021543598 7:21788563-21788585 CTGCTGGTGGGGAGAGAGGAAGG - Intronic
1022283489 7:28933560-28933582 CTGCCGGGGAGGAGTGAAGAAGG + Intergenic
1022469843 7:30675320-30675342 CTGGTGGTAAGGAGTGCACAGGG + Intronic
1022635790 7:32133505-32133527 CTGCTGCCAGGGAGTGAGGAAGG + Intronic
1023513419 7:40977210-40977232 CTGCTGGGAGGGAGAGAAAAGGG + Intergenic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029481575 7:100816669-100816691 CTGGGGGTACAGAGTGAAGCAGG + Intronic
1029588608 7:101492039-101492061 CTGCTGGGATGGAATGATGAGGG + Intronic
1030420805 7:109304216-109304238 CTGCTGGATAGGGGTGAAGACGG - Intergenic
1030507937 7:110447818-110447840 CAGCTAGTAAGGAGTGAAGTGGG - Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034579312 7:152028747-152028769 CTGCTGGATAGGGGTGAAGAAGG + Intronic
1035693093 8:1572586-1572608 CTGCTGGTATGGAGAGGAGAGGG + Intronic
1036616853 8:10394706-10394728 CTGCTGGGGCAGAGTGCAGAAGG - Intronic
1037933082 8:22895370-22895392 CTCCTGGGACAGAGTGAAGGAGG - Intronic
1040904624 8:52453654-52453676 GTGCTGGTGGGGAGTGGAGATGG - Intronic
1040999574 8:53437509-53437531 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
1041002806 8:53468357-53468379 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1041096935 8:54359771-54359793 CTGCTGCTACCTTGTGAAGAAGG + Intergenic
1041569815 8:59324744-59324766 ATGCTGATACAGATTGAAGAGGG + Intergenic
1044004636 8:86926265-86926287 CTGCTGGATAGGGGTGAAGAAGG + Intronic
1045858874 8:106793529-106793551 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1048561085 8:135538221-135538243 CTGCTGGTTCAGATTGAAGATGG + Intronic
1048757600 8:137755750-137755772 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
1049877615 8:145035786-145035808 CTGCTGGATAGGGGTGAAGACGG - Intergenic
1052798721 9:32947549-32947571 CTGCTAATACGGAGAGAAGTTGG + Intergenic
1054743925 9:68835294-68835316 CTGCTGGTGAGGAAGGAAGACGG - Intronic
1056507592 9:87271614-87271636 CTGAAGACACGGAGTGAAGAAGG - Intergenic
1056888824 9:90470244-90470266 CTGCTGGGACAGACTGAAGTGGG + Intergenic
1057307435 9:93920459-93920481 CTGGGGGTCAGGAGTGAAGAAGG + Intergenic
1059577553 9:115507173-115507195 CTTCTGAGAAGGAGTGAAGAGGG + Intergenic
1062094512 9:134695913-134695935 CTTCTGGTCGGGACTGAAGATGG + Intronic
1187492754 X:19767601-19767623 TTTCTGGTACTGAGTGATGAGGG - Intronic
1187600602 X:20825139-20825161 CTGGGGGTAGGGAGTGGAGAAGG - Intergenic
1194294314 X:92109428-92109450 CTGATTGTTCGGATTGAAGATGG + Intronic
1195551978 X:106181678-106181700 CTGCTGGATAGGGGTGAAGAAGG + Intronic
1195570837 X:106397001-106397023 CTGCAGGCACCGAGTGGAGAGGG + Intergenic
1195850615 X:109278234-109278256 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
1197359737 X:125485694-125485716 GTGCTGCTGAGGAGTGAAGATGG - Intergenic
1197717646 X:129720836-129720858 CTGCTGACACACAGTGAAGAGGG - Intergenic
1198409441 X:136350888-136350910 CTGCAGGTAGGGATTGGAGAAGG - Intronic
1198847551 X:140928956-140928978 CAGTTTGTACTGAGTGAAGATGG - Intergenic
1200611818 Y:5333946-5333968 CTGATTGTTCGGACTGAAGATGG + Intronic
1200960066 Y:8988318-8988340 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1201022262 Y:9671700-9671722 CTGCTGGTTAGAGGTGAAGAAGG + Intergenic
1201404575 Y:13636686-13636708 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1201430428 Y:13896965-13896987 CTGCTGGACAGGAGTGATGAAGG - Intergenic
1201488059 Y:14512542-14512564 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1201648463 Y:16261060-16261082 CTGCTGGATAGGGGTGAAGAAGG + Intergenic
1201654347 Y:16324241-16324263 CTGCTGGATAGGGGTGAAGAAGG - Intergenic
1201989258 Y:20006991-20007013 CTGCTGGATAGGGGTGAAGAAGG + Intergenic