ID: 1150617920

View in Genome Browser
Species Human (GRCh38)
Location 17:66786255-66786277
Sequence GTTACCAGGCTGAGAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 309}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150617920_1150617925 4 Left 1150617920 17:66786255-66786277 CCTTCCTCTCTCAGCCTGGTAAC 0: 1
1: 0
2: 0
3: 39
4: 309
Right 1150617925 17:66786282-66786304 AACCCAGTCAAAGCGGATGAGGG 0: 1
1: 0
2: 0
3: 9
4: 107
1150617920_1150617929 17 Left 1150617920 17:66786255-66786277 CCTTCCTCTCTCAGCCTGGTAAC 0: 1
1: 0
2: 0
3: 39
4: 309
Right 1150617929 17:66786295-66786317 CGGATGAGGGAGGAGTCCAATGG 0: 1
1: 0
2: 0
3: 6
4: 153
1150617920_1150617924 3 Left 1150617920 17:66786255-66786277 CCTTCCTCTCTCAGCCTGGTAAC 0: 1
1: 0
2: 0
3: 39
4: 309
Right 1150617924 17:66786281-66786303 AAACCCAGTCAAAGCGGATGAGG 0: 1
1: 0
2: 0
3: 2
4: 118
1150617920_1150617930 26 Left 1150617920 17:66786255-66786277 CCTTCCTCTCTCAGCCTGGTAAC 0: 1
1: 0
2: 0
3: 39
4: 309
Right 1150617930 17:66786304-66786326 GAGGAGTCCAATGGAAGCTAAGG 0: 1
1: 0
2: 1
3: 10
4: 118
1150617920_1150617923 -3 Left 1150617920 17:66786255-66786277 CCTTCCTCTCTCAGCCTGGTAAC 0: 1
1: 0
2: 0
3: 39
4: 309
Right 1150617923 17:66786275-66786297 AACTGTAAACCCAGTCAAAGCGG 0: 1
1: 0
2: 0
3: 17
4: 184
1150617920_1150617928 7 Left 1150617920 17:66786255-66786277 CCTTCCTCTCTCAGCCTGGTAAC 0: 1
1: 0
2: 0
3: 39
4: 309
Right 1150617928 17:66786285-66786307 CCAGTCAAAGCGGATGAGGGAGG 0: 1
1: 1
2: 0
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150617920 Original CRISPR GTTACCAGGCTGAGAGAGGA AGG (reversed) Intronic
901220826 1:7582923-7582945 GATACTGTGCTGAGAGAGGACGG - Intronic
902783924 1:18721050-18721072 GTCACTAGGCTGGGAGAGAAAGG - Intronic
902798856 1:18817161-18817183 GTGATGAGGCTGGGAGAGGAAGG - Intergenic
902872559 1:19323287-19323309 GTTAGGAGGCTGAGGGAGGCAGG + Intronic
905081167 1:35322125-35322147 TTTACCAGTCTGAGAGAAAATGG + Intronic
905813960 1:40933532-40933554 GTTGCCAGGCCAAGAGGGGATGG + Intergenic
910081297 1:83345168-83345190 GTTACCATGATGATAGAGGATGG + Intergenic
910169843 1:84366274-84366296 GACCCCAGGCAGAGAGAGGAGGG - Intronic
910611253 1:89144894-89144916 GTTACCAGACAGAGAGGGGTAGG - Intronic
911127471 1:94353833-94353855 AAGAACAGGCTGAGAGAGGATGG - Intergenic
915115063 1:153592861-153592883 GTTACAGGGCTCAGAGAGAAAGG + Intergenic
915489321 1:156242622-156242644 GGGACCAGGGTGAGAGGGGAGGG - Intronic
915836757 1:159183002-159183024 TTTTCCAGGCTGAATGAGGAGGG - Intronic
917340207 1:173968807-173968829 ATTACCATGCTGAGAAAGTATGG + Intronic
917544974 1:175955410-175955432 GTTCCTAGTCTGAGAGAGAAAGG - Intronic
917985789 1:180317329-180317351 GTTACCAGGGGCAGGGAGGAGGG + Intronic
918296166 1:183159471-183159493 GTGAACAGGCTGAGAGATGGTGG + Intergenic
918448981 1:184641144-184641166 GTTCCCAGGCTCAGCCAGGAGGG + Intergenic
919847557 1:201651096-201651118 GAAAGCAGGGTGAGAGAGGAAGG + Intronic
919855442 1:201703284-201703306 GTCTCCAGGCTGAGACAGGCAGG + Intronic
920626309 1:207604843-207604865 GTTACCAGGCACTGAGAGGTGGG + Intronic
920957836 1:210635389-210635411 CTTAGTAGGCTGAGAGAGGCAGG + Intronic
921278942 1:213546339-213546361 GTCAGCAGGCAGAGTGAGGATGG + Intergenic
921689940 1:218137198-218137220 TTTAGCAGGCTGAGGCAGGAGGG + Intergenic
922355874 1:224774573-224774595 GTCAGCAGGCAGAGAGAGGGAGG - Intergenic
1062766114 10:66535-66557 GTTACTCGGGTGACAGAGGAGGG + Intergenic
1062780398 10:199673-199695 TTTAGGAGGCTGAGACAGGAGGG - Intronic
1063080166 10:2760328-2760350 GTAATTAGGGTGAGAGAGGAAGG + Intergenic
1063212118 10:3890357-3890379 GACAACAGGCTGAGAGAGGAGGG - Intergenic
1063227394 10:4028303-4028325 GTTCCCCAGCGGAGAGAGGAGGG - Intergenic
1064044881 10:12003998-12004020 GTAACCCGGGTGAGAGAGGATGG + Intronic
1065317920 10:24482775-24482797 GTTAGGAGGCTGAGGCAGGAGGG + Intronic
1066960163 10:42215267-42215289 GATTTCAGGCTGAGAGAGAATGG - Intergenic
1069583937 10:69584533-69584555 GCTACCCAGGTGAGAGAGGATGG + Intergenic
1069842244 10:71347082-71347104 GTTTCCAGGCTGTGGGAAGATGG + Intronic
1070530509 10:77332643-77332665 GTCACCAGGCAGAGCTAGGAGGG + Intronic
1070542938 10:77430012-77430034 GTGACATGGCTGTGAGAGGATGG - Intronic
1071562490 10:86655085-86655107 ATAAACAGGCTGATAGAGGAGGG + Intronic
1073526235 10:104184800-104184822 GTCAGGAGGCTGAGAGAGGGAGG - Intronic
1074671373 10:115796008-115796030 GTGCCCAGGCAGAGTGAGGAGGG - Intronic
1074997344 10:118769487-118769509 GTGACCAGGATGAGTCAGGACGG - Intergenic
1075903534 10:126062322-126062344 GTTACCAGGGAGAGAGTGGGTGG + Intronic
1076313149 10:129522274-129522296 GGTCACAGGCTGGGAGAGGAGGG + Intronic
1076507832 10:130989697-130989719 ATTACCAGGCTGGCAGATGACGG + Intergenic
1077152095 11:1077103-1077125 GGCACCAGGTTGGGAGAGGAGGG - Intergenic
1077774812 11:5258931-5258953 GCTACCAGGGTGAGTAAGGAAGG - Intronic
1078728105 11:13950352-13950374 GTTACTAGGCTGATAGAAGAAGG + Intergenic
1079129004 11:17736707-17736729 CGTACCAGGGTAAGAGAGGAAGG + Intronic
1079136283 11:17777486-17777508 GTCTCCGGGCTGAGGGAGGAGGG - Intronic
1080313292 11:30919913-30919935 GTTCCCAGGCTGGTAGAGGGAGG + Intronic
1081456519 11:43228645-43228667 GTTACCAGGGTCAGAGAGTGGGG - Intergenic
1081487139 11:43539715-43539737 GTTACCAGGAGCAGAGGGGAAGG + Intergenic
1081808421 11:45902291-45902313 GTCACCAAGCTGAGAGTGGCAGG + Intronic
1084376728 11:68783003-68783025 GATTCCAGGCTCTGAGAGGAGGG + Intronic
1085045189 11:73348608-73348630 GGTGCCAGGCTGGGAAAGGAGGG + Intronic
1086132102 11:83411456-83411478 GTGACCAGGATGAGAAAGAAAGG - Intergenic
1086242683 11:84714755-84714777 GTTACCAGGCAAACAGAAGAAGG - Intronic
1088736510 11:112732181-112732203 CTAAACATGCTGAGAGAGGATGG - Intergenic
1089223329 11:116894103-116894125 GTTCCCAGGAGGAGGGAGGAGGG - Intronic
1089665707 11:120017226-120017248 GTCACCCGGCTGATAGATGATGG - Intergenic
1090271191 11:125387475-125387497 TTTTCCAGGCTGAGCTAGGATGG - Intronic
1090633090 11:128667875-128667897 GTCACAAGGCTGAGTGAAGATGG - Intergenic
1091164684 11:133464707-133464729 GTTACCAGGAACACAGAGGAGGG + Intronic
1091302338 11:134515480-134515502 GTTACCAGGTAGCGAGAGGCAGG - Intergenic
1091386808 12:101164-101186 GCTTGCAGGCTGAGAGTGGATGG - Intronic
1092403655 12:8199155-8199177 GTTTCCAGGGTGTGACAGGAGGG - Intergenic
1092473580 12:8799695-8799717 TTTGCGAGGCTGAGACAGGAGGG + Intergenic
1092496645 12:9002672-9002694 CTTAGGAGGCTGAGACAGGAGGG - Intronic
1098286813 12:68915478-68915500 ATTACCAGGCAGAGAGATGGAGG - Intronic
1099685046 12:85874388-85874410 GTTAGAAGGCTGAAAGATGATGG + Exonic
1101361703 12:104033482-104033504 GTTACCAGGGACAGAGAGGTGGG + Intronic
1102288827 12:111682388-111682410 CTTGGGAGGCTGAGAGAGGAAGG + Intronic
1103936377 12:124479746-124479768 GATGCCAGGCAGAGGGAGGAGGG + Intronic
1104623003 12:130332342-130332364 ATTACCAGCCTTAGAAAGGACGG - Intergenic
1107548246 13:41453982-41454004 ATATCCAGGCTGGGAGAGGATGG + Intergenic
1107656337 13:42595541-42595563 GTTACCAGGCTGAGGAAGCTGGG - Intronic
1108702479 13:52955553-52955575 GAAGCAAGGCTGAGAGAGGAAGG - Intergenic
1108861457 13:54864875-54864897 ATAACCATGCTGGGAGAGGATGG + Intergenic
1109029390 13:57173819-57173841 GTTACAAAGCTGAGACAAGAGGG - Intergenic
1109719480 13:66258748-66258770 TTTGACAGGCTGAGAGAAGAAGG - Intergenic
1110191308 13:72732257-72732279 GTTACCAAGCAAAGAGAAGATGG - Intronic
1110712209 13:78662548-78662570 ATTCCCAGCCTGTGAGAGGACGG - Intergenic
1112546206 13:100373578-100373600 GTTGCCAGGGGCAGAGAGGAAGG + Intronic
1113197278 13:107823325-107823347 CTTACCCAGGTGAGAGAGGATGG - Intronic
1113914348 13:113861906-113861928 GGGGCCAGGCTGTGAGAGGATGG + Intronic
1114455507 14:22851001-22851023 TTCACAAGACTGAGAGAGGAGGG - Intergenic
1115680338 14:35730787-35730809 GTTACCAGGATGAGTAGGGAAGG - Intronic
1115757968 14:36548842-36548864 TTCACCAGCTTGAGAGAGGAAGG - Intergenic
1117339734 14:54783007-54783029 GTTCCCAGGCTCACAGAGGAAGG + Intronic
1118158772 14:63267738-63267760 GTTACCATGCTGACAGAAGAAGG - Intronic
1119451319 14:74713192-74713214 GTGACCATGGTGAGAGAAGACGG + Exonic
1120360905 14:83500731-83500753 GATACTAGGCTCAGAGTGGATGG - Intergenic
1120810898 14:88802556-88802578 TTTAACAGGCTGACAGTGGATGG - Intergenic
1121534569 14:94682295-94682317 GTCACCAGGAGGAGAGGGGAAGG + Intergenic
1122912027 14:104834969-104834991 GTTACCAGGCCTAGAGGGAAGGG - Intergenic
1124533515 15:30525304-30525326 GAAACAAGGCTGAGAGAGAAGGG - Intergenic
1125788477 15:42343844-42343866 GTCACCAGACTAAGGGAGGAGGG + Intronic
1126255191 15:46617094-46617116 ATTTTCAGGCTGAGAGAGAATGG - Intergenic
1126339832 15:47627148-47627170 ATTACCAGGTTGGGAGAAGATGG - Intronic
1126745156 15:51818388-51818410 GTTATCAAGCTGAGAGACGTTGG - Intergenic
1127067419 15:55255243-55255265 GCTTCCAGGGTGAGAGTGGAAGG - Intronic
1127242935 15:57138383-57138405 GTTAACAGGGTAAGAGAAGAAGG - Intronic
1127784750 15:62345887-62345909 TTTACCAGGCTGAGGGGGGTAGG + Intergenic
1128438065 15:67675424-67675446 GTTACCAGGGGCTGAGAGGATGG + Intronic
1129227172 15:74176736-74176758 GGTTGCAGGCTGAGGGAGGAAGG - Exonic
1130808862 15:87355648-87355670 GTAACCAAGCTGAGAGAGGCTGG - Intergenic
1132229721 15:100172484-100172506 GTGACCAGGATGAGTCAGGATGG - Intronic
1132571868 16:647769-647791 GCTGCCAGGCTGTGGGAGGAGGG - Exonic
1132830669 16:1926526-1926548 GTGACCAGCCTGGGAGATGAGGG - Intergenic
1133214558 16:4283692-4283714 GTTCCCAGGCACAGAGAGGGAGG - Intergenic
1135531837 16:23261216-23261238 GTTACCAGGGTTACAGAGGGAGG + Intergenic
1135845359 16:25913663-25913685 GTTACTAGGTTGAGAGAAAATGG + Intronic
1136394137 16:29983675-29983697 GCGAGCAGGCTGAGTGAGGATGG - Intronic
1137578190 16:49617717-49617739 GGTTCCAGGCTGGGAGAGGAGGG - Intronic
1138894680 16:61189283-61189305 GTAATCAGGCTAAGACAGGAAGG + Intergenic
1141136586 16:81469536-81469558 GTTACCAAGATTACAGAGGAGGG + Intronic
1141443713 16:84045125-84045147 GTACCCAGGCTGGGAGAGGGCGG + Intergenic
1145285576 17:21503791-21503813 ATTTCCAGGCAGACAGAGGATGG + Intergenic
1147389011 17:40098099-40098121 GTTACCAGGCTGAGATCTGAAGG - Intronic
1147932896 17:43994232-43994254 GTTCCCAGGCAGAGAGAGGGGGG - Intronic
1148892259 17:50816798-50816820 GTTGCCAGGCTGAGGGAAGCAGG - Intergenic
1149656462 17:58311934-58311956 GGAACCAGGCTGGGAGAGGCTGG - Exonic
1150617920 17:66786255-66786277 GTTACCAGGCTGAGAGAGGAAGG - Intronic
1150684878 17:67312501-67312523 GTTGCCAGGCAGAGGGTGGATGG - Intergenic
1151321749 17:73356696-73356718 GTAACCAGGCACAGGGAGGAGGG - Intronic
1151322281 17:73359263-73359285 GTTGCCAGGCTGTGTAAGGAGGG - Intronic
1153168962 18:2293406-2293428 GTTACCAGGGTGAGTAGGGAAGG + Intergenic
1156450551 18:37264013-37264035 GTAACCAGGCTGAGAGGGTCAGG - Intronic
1156628345 18:38937349-38937371 GTTTCCAGGCTGAGACTGGGAGG - Intergenic
1156648475 18:39196560-39196582 GTTACCAACATGAGAGAGAATGG - Intergenic
1157121616 18:44916910-44916932 GTTACCAGGTTCAGGGAGGTGGG - Intronic
1158114910 18:53984447-53984469 TTTAGGAGGCTGAGGGAGGAGGG + Intergenic
1159872222 18:73771353-73771375 GTTATCAGGCTGAGAAATGAAGG - Intergenic
1161830005 19:6595942-6595964 GTGAGCAGGCTCAGAGAGGAAGG + Intronic
1162198251 19:9002379-9002401 TTTTCCAGGTTGAGAAAGGAGGG + Intergenic
1163038180 19:14583625-14583647 GTGAGCAGGGTGAGAGAGGAGGG + Intronic
1163038867 19:14587882-14587904 GTGAGCAGGGTGAGAGAGGAGGG + Intronic
1165126191 19:33599580-33599602 TTTTCCAGGGTGAGACAGGAAGG - Intergenic
1166343027 19:42150144-42150166 GTCACCAGGCAGGGAGACGATGG - Intronic
1167600365 19:50451352-50451374 GGGACCGGGCTGAGGGAGGAGGG + Intronic
1167879524 19:52444588-52444610 GTTACCAGGGTGGGTAAGGAAGG + Intronic
1168021513 19:53612273-53612295 GTTAGGAGGCTGAGACAGGAGGG + Intergenic
1168147982 19:54430229-54430251 GGTGCCAGGAAGAGAGAGGAGGG + Intronic
1168545105 19:57243783-57243805 TGTACCAGGCTGAAGGAGGAAGG - Intronic
925479130 2:4250898-4250920 GTTACCAGGGTGAGTAAGGAAGG + Intergenic
926961609 2:18364004-18364026 GTTTGCAGGATGAGAGAGGCTGG + Intergenic
927092013 2:19719393-19719415 GTTCCCAGGCAGAGAGAGCTGGG - Intergenic
927170525 2:20365714-20365736 GTAACCCAGCTGAGAGATGATGG - Intergenic
928023169 2:27719877-27719899 GTATCCGGGCTGATAGAGGAGGG - Intergenic
930136689 2:47909107-47909129 GTTTCCACCCTGAGAGGGGATGG + Intergenic
930615414 2:53588043-53588065 TTTGACAGGCTGAGAGAAGAAGG + Intronic
931285302 2:60827245-60827267 GTGACCAGGCAGAGAAAGGATGG - Intergenic
931718013 2:65044561-65044583 GTGACCAGGATGAGTCAGGATGG + Intergenic
932268400 2:70387720-70387742 ATCAGCAGCCTGAGAGAGGATGG - Intergenic
932432644 2:71685111-71685133 GCTGCCTGGCTGGGAGAGGAAGG + Intronic
932758762 2:74426233-74426255 GTCACCAGTGTGAGAGAGAAAGG - Exonic
933897346 2:86823932-86823954 GGGTCCAGGCAGAGAGAGGAGGG + Intronic
933994482 2:87657839-87657861 GTGACCAGGTGGAGAGAGGAAGG + Intergenic
934312940 2:91886558-91886580 TTTAGGAGGCTGAGACAGGAAGG + Intergenic
935236903 2:101146864-101146886 GTTACCAGGATGGGAGAAGATGG - Intronic
935269294 2:101419858-101419880 GTTCCCAGCCTGAGAGAAAAGGG - Intronic
935464255 2:103377531-103377553 CTTAGCAGGCTGAGAGAGAGAGG - Intergenic
935541981 2:104359175-104359197 GTTTCCAAGGTGAGAAAGGAAGG + Intergenic
935829559 2:106986815-106986837 GTTACCAGACTTAGACATGAGGG - Intergenic
936299376 2:111293074-111293096 GTGACCAGGTGGAGAGAGGAAGG - Intergenic
936630622 2:114199018-114199040 CTTTCCAGGCTGAGGGAGAAAGG - Intergenic
936679458 2:114753524-114753546 GTCACAAGGCTAAGAGATGAAGG - Intronic
937218058 2:120325141-120325163 GTTGTGAGGCTGAGAGAGCAGGG - Intergenic
937227884 2:120380134-120380156 GTAACCAGGCTGAGGTCGGAGGG - Intergenic
938127567 2:128685559-128685581 GACCCCTGGCTGAGAGAGGAAGG - Intergenic
938987298 2:136590252-136590274 GTTAGCAGGCAGAGAGATAAAGG - Intergenic
939688868 2:145232940-145232962 GTGAGCAGGCTCAGAGAGGCAGG - Intergenic
941901237 2:170680791-170680813 CTCCCCAGGCTGTGAGAGGAAGG + Intergenic
942957297 2:181788147-181788169 GAGACCAGGCTGTGACAGGAGGG - Intergenic
943685897 2:190818050-190818072 GTTAGGAGGCAGAGAGAGCAAGG + Intergenic
945768871 2:214015237-214015259 CTTATCAGGCTAAAAGAGGAAGG + Intronic
945977052 2:216279184-216279206 GTTACTAGGCAAAGAAAGGAGGG + Intronic
947130861 2:226923628-226923650 GTTACTGGCCTGAAAGAGGATGG - Intronic
948710284 2:239821004-239821026 GTTCCCAGGCAGAGATTGGAGGG + Intergenic
948839975 2:240644118-240644140 GTTACCAGGCTGAGGCTTGAGGG - Intergenic
1169282711 20:4280786-4280808 GCTCCCAGGCTGGGAGAGGAAGG + Intergenic
1172441958 20:34972048-34972070 GTCACCCGGGTGAGAGCGGATGG - Intergenic
1172852707 20:37978072-37978094 GTTACCAGGAAGAGAGATGCTGG - Intergenic
1174207424 20:48850820-48850842 TTTGCCAGGCAGACAGAGGAAGG - Intergenic
1174721766 20:52820386-52820408 TTTACCAGGTAGAGAAAGGAGGG - Intergenic
1176119743 20:63448913-63448935 ATTGCAAGGCTGAGACAGGAGGG - Intronic
1176136475 20:63524390-63524412 GGTACCAGGATGAGTCAGGACGG + Intergenic
1177557934 21:22715726-22715748 CTTACCAGGCTGAAAAAGAAGGG - Intergenic
1180234610 21:46450266-46450288 ATTAGGAGGCAGAGAGAGGATGG - Intergenic
1180625599 22:17191606-17191628 GCTACTAGGCTGGGAGGGGAGGG - Intronic
1182418783 22:30238521-30238543 TCTCCCAGGCTGAGAGAGGCAGG + Intergenic
1182554092 22:31119662-31119684 GTGACCAGGGAGAGAAAGGAAGG + Intronic
1182747723 22:32618354-32618376 GTTTCCAAGCTGAAAGTGGATGG + Intronic
1182819440 22:33202400-33202422 GTTTCATGCCTGAGAGAGGAAGG - Intronic
1183091523 22:35525465-35525487 GTTCCCAGGCAGAGGGAGGGCGG + Intergenic
1183358493 22:37371693-37371715 GTTACCATGGTGACAGAGGCTGG + Exonic
1184513451 22:44946182-44946204 GAGCCCAGGCTGAGAGTGGAGGG + Intronic
1184924148 22:47625757-47625779 GTTGCCAGGCTGGCAGAAGAGGG - Intergenic
950111422 3:10421141-10421163 GCCACCAGCCTGAGGGAGGAGGG + Intronic
950280703 3:11705363-11705385 CTTGGCAGGCAGAGAGAGGAGGG + Intronic
950883126 3:16339149-16339171 GTTACCAGGCAGAGAAAGTTAGG - Intronic
951562925 3:23986326-23986348 GTTACCAGGGTTTGGGAGGAGGG + Intergenic
951936293 3:28026124-28026146 TTTACCAGGGGCAGAGAGGAAGG - Intergenic
952761710 3:36921051-36921073 GTAACCAGGATGAGTCAGGATGG - Intronic
952995545 3:38878195-38878217 GGTACCAGGCTGAGATGGGTGGG - Intronic
953357624 3:42267818-42267840 GTTTCCAGGCTGGGAGACAAGGG + Intergenic
956165767 3:66397180-66397202 GACACCAGACTGAGTGAGGAGGG - Intronic
958114679 3:89200848-89200870 GTTCCCAGTCTGAGTGAGTATGG + Intronic
958770690 3:98422026-98422048 GTTACCAGGGTGGGAAGGGAAGG - Intergenic
959749117 3:109812304-109812326 ATTATCAGGGTGAGAGATGATGG + Intergenic
959982226 3:112529026-112529048 ATATCCAGGCGGAGAGAGGAAGG + Intergenic
960453556 3:117841458-117841480 GCTACCAGGAAGAAAGAGGAGGG - Intergenic
960879738 3:122332267-122332289 GTCACCTGGCTAAGAGAGGAAGG - Intronic
961025939 3:123557401-123557423 TTTACCAGGCTGAGGTGGGAGGG + Intronic
961361669 3:126371997-126372019 ATGACCAGCCTTAGAGAGGAAGG + Intergenic
961868135 3:129968933-129968955 GTGACCAGGCTCAGTGAGGTGGG + Intergenic
962028460 3:131573376-131573398 GTCAGCAGACTGAGAAAGGAGGG + Intronic
963094514 3:141522161-141522183 TGTACCAGGCAAAGAGAGGAAGG + Intronic
965537018 3:169833712-169833734 GTTATCCGGCTGTGAGATGATGG - Intronic
966408597 3:179625707-179625729 GTTACAAGGCTGGGAAGGGAAGG - Intronic
967579128 3:191131420-191131442 GTTACCAGGAGCTGAGAGGAGGG + Intergenic
968134742 3:196213156-196213178 GTTGCCAGGGTGTGGGAGGAGGG + Intronic
969246991 4:5941466-5941488 GTTAGGAGGATGAGAGATGAGGG - Intronic
969723244 4:8904915-8904937 CTGTCCAGGCTGAGAGAAGAAGG - Intergenic
969762405 4:9198637-9198659 GTTTCCAGGGTGTGACAGGAGGG + Intergenic
970445552 4:16120824-16120846 GTTCCCAGGCATAGAGAGGAGGG - Intergenic
972699617 4:41481601-41481623 GTTGTCTGGCTGAGAGATGATGG + Intronic
973901621 4:55480506-55480528 TTTAGGAGGCTGAGATAGGAAGG - Intronic
973969304 4:56195236-56195258 GTTTCCAGGCTTAGAGGGGAGGG + Intronic
977333365 4:95664862-95664884 TTTGACAAGCTGAGAGAGGAAGG + Intergenic
977919979 4:102632258-102632280 GTCACCTTGCTGAGAGATGATGG + Exonic
978887881 4:113787089-113787111 GATACCAGGCTGAGAGATTAAGG + Intergenic
982075016 4:151730328-151730350 GTTACCAGGTTGAGTAGGGAAGG - Intronic
982076043 4:151738039-151738061 GGTACCACGCTGTGAGAGGAGGG + Intronic
983192393 4:164768457-164768479 GTAACCAGGTTGCCAGAGGAAGG + Intergenic
983994844 4:174169281-174169303 GTTTACAGGCTGAGTGAGGCTGG - Intergenic
984323795 4:178226470-178226492 GTTACCAGAGTGAGAAAGAAAGG + Intergenic
985696301 5:1342624-1342646 GTCACCAGGCTGAAAGTGTAGGG + Intronic
985947981 5:3201393-3201415 GATGCCAGGCGGAGAGGGGAGGG - Intergenic
986597373 5:9437751-9437773 CTTACCAAGGAGAGAGAGGATGG + Exonic
986889380 5:12282934-12282956 GTTGCCAGGAGTAGAGAGGAGGG - Intergenic
988499443 5:31772213-31772235 GTGACCAGGATGAGTTAGGATGG - Intronic
989332743 5:40278816-40278838 CTATCCAGGCTGAGGGAGGAAGG + Intergenic
990466314 5:56074866-56074888 CTTAGGAGGCTGAGGGAGGAGGG + Intergenic
990988441 5:61662131-61662153 GTTACCAAGGTGTGAGCGGAAGG + Intronic
992594069 5:78327829-78327851 GTAACCCAGGTGAGAGAGGATGG - Intergenic
993842694 5:92900460-92900482 ATTACCAGACTGAGTGTGGAAGG - Intergenic
994879636 5:105472669-105472691 GCTACTAGGCTGAGAGACTAAGG + Intergenic
995474572 5:112534686-112534708 ATTATCAGGCTGGGGGAGGAAGG + Intergenic
997385198 5:133466709-133466731 GTGAGCAGCCTGAGAGAGGCAGG - Intronic
997658854 5:135575039-135575061 GATCCCAGGCTCAGAGAGGCTGG - Intronic
998981930 5:147713642-147713664 ATTACCAGGCTGAGATCTGAGGG + Intronic
999665026 5:153904043-153904065 GGAAACAGGCTCAGAGAGGAGGG + Intergenic
1001196079 5:169674664-169674686 ATTACCAGGCTGAGAGATTTAGG + Intronic
1003094589 6:3132340-3132362 GGGAACAGCCTGAGAGAGGAGGG - Intronic
1003569797 6:7248277-7248299 GTGCCTGGGCTGAGAGAGGAAGG + Intronic
1004010564 6:11681998-11682020 GTTAGCAGGCAGAGGGAGCAGGG + Intergenic
1004089111 6:12481589-12481611 CTTGCGAGGCTGAGATAGGAGGG - Intergenic
1004731090 6:18359965-18359987 CTTAGGAGGCTGAGACAGGAGGG - Intergenic
1005018835 6:21398784-21398806 GTCACCAGGCTGAAAGCAGACGG + Intergenic
1005378886 6:25213982-25214004 GTTACCAGGGTGGGAGAACAGGG + Intergenic
1005693616 6:28330903-28330925 TTTATCAGGCAGAGAAAGGAAGG + Intronic
1005983535 6:30855856-30855878 GTTAGCAAGATGAGGGAGGAGGG - Intergenic
1006875315 6:37290402-37290424 ATTATCAGGTTGAGAGAAGATGG + Intronic
1007273845 6:40659102-40659124 ATTACCAGCCTGAGAAAGGCAGG + Intergenic
1007344071 6:41215090-41215112 GTGACCAGGATGAGTCAGGATGG + Intergenic
1007769312 6:44180410-44180432 GTTACCAGGGGGAGGGAGGTGGG - Intronic
1007777561 6:44232297-44232319 GTTATCAGGCTCACAGAGGCAGG - Intronic
1007791855 6:44313738-44313760 TTTTCCAGGCTGAGGGAAGAAGG + Intronic
1009369275 6:62880453-62880475 ATAACCAGGTTGGGAGAGGATGG + Intergenic
1010508283 6:76687100-76687122 TTTAGTAGGCTGGGAGAGGAGGG - Intergenic
1011241301 6:85274028-85274050 GTTACTTAGCTGAGAGTGGAAGG - Intergenic
1012577518 6:100821256-100821278 TTTGCGAGGCTGAGACAGGAGGG - Intronic
1013309254 6:108878470-108878492 TTTATCTGGCTGGGAGAGGAAGG + Intronic
1013919637 6:115388182-115388204 CTTACTAGGCTGAGAAATGAAGG - Intergenic
1014708770 6:124781470-124781492 GTTACCAGGATGTGAGGGGTTGG + Intronic
1015934497 6:138395042-138395064 TTTAGGAGGCTGAGACAGGAGGG - Intergenic
1017403385 6:154090188-154090210 GTTACCAGCCTGAGGGAAGGAGG + Intronic
1018100783 6:160437822-160437844 GATATCAGGGAGAGAGAGGACGG + Intronic
1018809158 6:167285144-167285166 GTTACCTGCCCGAGAGAGGGTGG + Intronic
1020360632 7:7323251-7323273 GTTAACAGGGGGAGATAGGATGG - Intergenic
1021401544 7:20214991-20215013 GTACCCAGGCTGCCAGAGGAAGG - Intronic
1021576865 7:22112986-22113008 ATTACCAGGTAGAGAGAGGTGGG + Intergenic
1022973762 7:35538888-35538910 GTGACCAGGCGGACAGAGGAGGG - Intergenic
1023090293 7:36611132-36611154 GTGGCCAGGCTGAGAGTGGCTGG + Intronic
1023821443 7:43982881-43982903 GCTACCAGGCTGGGAGAGGCAGG - Intergenic
1023873782 7:44276192-44276214 GTCTCCAGGCTGGGAGGGGAGGG + Intronic
1024505818 7:50160411-50160433 TTTACCAGGATGAAAGAGGAAGG + Intergenic
1026443839 7:70466916-70466938 GTTACCCAGGTGAGAGAGGATGG + Intronic
1026923675 7:74174341-74174363 GGAACCAGGGTGAGCGAGGAAGG - Exonic
1026996809 7:74622378-74622400 TTTAGGAGGCTGAGGGAGGAGGG + Intergenic
1027298775 7:76807413-76807435 GTTACCACGATGATAGAGGATGG + Intergenic
1028254722 7:88579970-88579992 GCTTCCAGGCTGAGAAGGGATGG - Intergenic
1028430235 7:90737776-90737798 GGTATGAGGGTGAGAGAGGAAGG - Intronic
1029749706 7:102536302-102536324 GCTACCAGGCTGGGAGAGGCAGG - Intergenic
1029767656 7:102635407-102635429 GCTACCAGGCTGGGAGAGGCAGG - Intronic
1030997151 7:116372392-116372414 TTTGACAAGCTGAGAGAGGAAGG + Intronic
1031832672 7:126646481-126646503 GTTTCAATGCTGAGAGAGGGAGG - Intronic
1032229492 7:130061933-130061955 GTTGCCAGGGAGGGAGAGGAGGG - Intergenic
1032616935 7:133482943-133482965 TGTGACAGGCTGAGAGAGGAGGG - Intronic
1033425985 7:141244763-141244785 GTTTCCAGGATGAAAGAGGAAGG + Intronic
1034010573 7:147524990-147525012 GTTAGCAGGCAAAGAAAGGATGG + Intronic
1035334946 7:158121801-158121823 CTTGCCAGGCTGAGGAAGGAAGG - Intronic
1036272489 8:7320373-7320395 GTTTCCAGGGTGTGACAGGAGGG + Intergenic
1036348859 8:7989971-7989993 GTTTCCAGGGTGTGACAGGAGGG - Intergenic
1036520150 8:9484216-9484238 GTTCCCAGCTTGAGAGAGAATGG + Intergenic
1036844121 8:12150444-12150466 GTTTCCAGGGTGTGACAGGAGGG - Intergenic
1036865496 8:12392765-12392787 GTTTCCAGGGTGTGACAGGAGGG - Intergenic
1037360108 8:18064051-18064073 GTTGCCTGGCTGGGAAAGGATGG + Intronic
1039273079 8:35904481-35904503 GTTTGCAGGCTGAGCGAGGAAGG - Intergenic
1039907343 8:41796816-41796838 GCTGCCAGGCAGAGATAGGACGG + Intronic
1042335919 8:67630286-67630308 GGTCCCAGGCTGAGTGAGCATGG - Intronic
1044789408 8:95832430-95832452 GTTGCCAGGGTGAGGGAGGAGGG + Intergenic
1045348792 8:101318733-101318755 GTTGCCAGGAGTAGAGAGGAAGG + Intergenic
1048021187 8:130540671-130540693 GTAAACAGGCTGTGAGAGGGAGG + Intergenic
1049006900 8:139861433-139861455 GTGACCAGGATGAGTCAGGATGG + Intronic
1050580606 9:7051391-7051413 GTGATCAGACTCAGAGAGGATGG + Intronic
1053299491 9:36938923-36938945 CTAATCTGGCTGAGAGAGGAGGG - Intronic
1055057278 9:72035520-72035542 GTTAGTAGGCTCAGAGAAGACGG + Intergenic
1055372191 9:75611904-75611926 GATACAAGGCAGAGAGAAGAAGG + Intergenic
1056421910 9:86436709-86436731 GTAACCAGGATGAGTCAGGATGG - Intergenic
1056901103 9:90600215-90600237 GTGAGGAGGCTGAGAGAGGAGGG - Intergenic
1057553750 9:96071444-96071466 GTGACCAGGCTGAGAAAGCCAGG + Intergenic
1058108157 9:100999361-100999383 GTTATCAGGGGAAGAGAGGATGG + Intergenic
1058267481 9:102921430-102921452 ATTTCCAGGATGAGAGAGAAAGG + Intergenic
1058892642 9:109374141-109374163 GTAAGCAGGCTAAGACAGGAGGG + Intergenic
1058901990 9:109449947-109449969 GTTATGAGGCTGAGATAAGAGGG - Intronic
1059345310 9:113624270-113624292 GTGACCAGGCAGAAAGAGCATGG + Intergenic
1059377926 9:113900476-113900498 GTAAACAGGCACAGAGAGGAAGG + Intronic
1061108330 9:128549682-128549704 GTTACCAGGGTCTGAGGGGAGGG - Intergenic
1061255406 9:129452229-129452251 GTGACCAGGCAGGGCGAGGATGG + Intergenic
1061367785 9:130181607-130181629 GACTCCAGGCTGAGAGGGGACGG - Intronic
1061607081 9:131718714-131718736 GTTACCAGGCAGAGAGTGAAGGG + Intronic
1062260867 9:135662859-135662881 GTTACTGGGCTGAGAGAATAAGG + Intergenic
1062716076 9:138010853-138010875 GTTCCGGGGCTGAGAGAGGCAGG + Intronic
1062739126 9:138157760-138157782 GTTACTCGGGTGACAGAGGAGGG - Intergenic
1187252306 X:17609608-17609630 GTTAGCATGTTGAGAGATGATGG + Intronic
1187671251 X:21667870-21667892 GGGACCAGTCTGGGAGAGGAGGG - Intergenic
1188657345 X:32715105-32715127 GTTACCAGGTTGGGGGTGGAAGG - Intronic
1189674938 X:43452161-43452183 GTGACCAGGATGAGTCAGGATGG - Intergenic
1192192436 X:68999565-68999587 TCAGCCAGGCTGAGAGAGGAAGG - Intergenic
1194822093 X:98522537-98522559 GTTATCAGGCTGAGAGAATAAGG - Intergenic
1195172077 X:102279767-102279789 GTTATTAGGCTTAAAGAGGAGGG - Intergenic
1195186783 X:102407326-102407348 GTTATTAGGCTTAAAGAGGAGGG + Intronic
1196225167 X:113157801-113157823 GTTACCAGGGTGCGTGCGGAAGG + Intergenic
1196542885 X:116930384-116930406 GTTACCAGACTGAGAAACAAAGG + Intergenic
1197522853 X:127521056-127521078 GGTACCAGAAAGAGAGAGGATGG + Intergenic
1198117049 X:133554560-133554582 GTGACCAGGGTGAGTCAGGATGG - Intronic
1198327472 X:135587558-135587580 GTTTCTTAGCTGAGAGAGGAGGG - Intergenic