ID: 1150620434

View in Genome Browser
Species Human (GRCh38)
Location 17:66803790-66803812
Sequence TCCGAGGGCCCTCTCTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150620434 Original CRISPR TCCGAGGGCCCTCTCTGGGG AGG (reversed) Intronic
900004586 1:36265-36287 TCTGAGGGGGCTCTCAGGGGTGG + Intergenic
900024308 1:206781-206803 TCTGAGGGGGCTCTCAGGGGTGG + Intergenic
900124496 1:1063421-1063443 CCCCAGGGCCCTCACAGGGGAGG - Intergenic
900139889 1:1135183-1135205 TCCCAGGCCCCTCCCTGGGGAGG - Intergenic
900192133 1:1356211-1356233 CCCGAGGGCCCTGGCAGGGGAGG + Intronic
900401867 1:2476025-2476047 TCCGAGGACCCTGTGTGGGGTGG - Intronic
900979617 1:6039031-6039053 CCCCAGTTCCCTCTCTGGGGGGG - Intronic
901926624 1:12570371-12570393 CCTGAGGGCCCTCTCTGTGCCGG - Intronic
902382106 1:16057628-16057650 TCCATGGGCCCTCTCTGGCTGGG + Intergenic
903830133 1:26169726-26169748 CCCGCGGGCCCTCGCTGGGGAGG - Intergenic
904611904 1:31730699-31730721 TACGAGAGGCCGCTCTGGGGAGG + Intronic
905627718 1:39499321-39499343 TCCCAGGGCCCTCCCTGCGCTGG - Intronic
905645118 1:39619864-39619886 TCTGAGGGAGTTCTCTGGGGAGG + Intergenic
910676653 1:89821890-89821912 TCCGCGGGCCGTCTCCGGGTTGG + Intronic
915691514 1:157695551-157695573 TCCCAGGGCCCACACTGTGGTGG - Exonic
920125967 1:203693970-203693992 TCCAGTGGCCCTCTGTGGGGTGG + Intronic
922776931 1:228219124-228219146 TGCCAGGGCCCTCACTGGGCAGG + Intronic
922920362 1:229296659-229296681 TCTGGGGGCCCTTTCTGGGTAGG + Intronic
922986580 1:229870562-229870584 TTTGAGTGCCCTCTCTGGGCTGG + Intergenic
923525152 1:234766928-234766950 TCCGGGAGCCATCTCTGAGGGGG - Intergenic
1067325761 10:45264570-45264592 TTCAAGGGCACTCTCTGGGTGGG - Intergenic
1069995648 10:72340721-72340743 TCCAAGCCCCCTCCCTGGGGTGG + Intronic
1072279289 10:93851380-93851402 TCCGTGGACCCTCTGTGGGTGGG - Intergenic
1074263849 10:111881609-111881631 TCCGAGGGACCACTCTGTGGTGG + Intergenic
1074550723 10:114439815-114439837 TTGGAGAGTCCTCTCTGGGGTGG - Intronic
1074864568 10:117537319-117537341 TGCGCGGGCCCTGCCTGGGGTGG - Intergenic
1075096866 10:119477731-119477753 GCCCAGCTCCCTCTCTGGGGAGG - Intergenic
1075689632 10:124386588-124386610 GGAGAGGGCCCTCTCTGGAGAGG - Intergenic
1077007862 11:367434-367456 TCCAGGGTCGCTCTCTGGGGAGG - Intergenic
1077032118 11:473197-473219 TGCGAGGGACCGCTCTGGGCAGG - Intronic
1077221945 11:1421833-1421855 TCAGAGGCCCCTCTCGGGGCAGG + Intronic
1077469085 11:2748442-2748464 GCTGAGGGCCCTGCCTGGGGAGG - Intronic
1078553158 11:12294152-12294174 TCCTGGGCCCCTCTCTGGGTTGG - Exonic
1083183726 11:61005347-61005369 CCCGAGGGACCTCACAGGGGGGG + Intronic
1083355305 11:62061816-62061838 TCCCACTGCCTTCTCTGGGGAGG + Intergenic
1083582641 11:63834934-63834956 TACCAGGGCCTTCTCTGGCGAGG + Intergenic
1083603465 11:63962664-63962686 TCTGGGGGCCGCCTCTGGGGTGG + Intergenic
1083996434 11:66275346-66275368 TTCGAGGGTCCTCTCAGAGGTGG - Intronic
1084145034 11:67260727-67260749 TCCTATGGCACGCTCTGGGGAGG - Intergenic
1084473539 11:69376535-69376557 TCTGCAGGCCCTATCTGGGGTGG + Intergenic
1084751795 11:71208998-71209020 GCCGAGTGTCCTCTCTGGTGAGG - Intronic
1084891140 11:72237704-72237726 TCCGAGGGCAGTCCCCGGGGGGG - Exonic
1089329424 11:117679347-117679369 TCCCCTGACCCTCTCTGGGGAGG - Intronic
1090400053 11:126443273-126443295 TCCGAGTGCCCTGGCTGGCGCGG + Intronic
1091378005 12:38317-38339 TCTGAGGGGGCTCTCAGGGGTGG + Intergenic
1091829727 12:3540936-3540958 TCCGGGGGGCCCCTCTGGGAGGG + Intronic
1097342405 12:58454134-58454156 TCCCAGGAGCCACTCTGGGGAGG - Intergenic
1098329006 12:69332946-69332968 CCAGATGGCCTTCTCTGGGGAGG - Intergenic
1100243090 12:92729424-92729446 TCAGAGTGCCCTCTCTAGGCTGG + Intronic
1102222712 12:111205214-111205236 TCAGAGGGCCAGCTCTGGGAGGG - Intronic
1103855993 12:123972203-123972225 TCTGCCGGCCCTTTCTGGGGAGG - Intronic
1103879781 12:124157285-124157307 CAGGAGGGCCCTCTCTGGGAGGG + Intronic
1103930493 12:124448279-124448301 TCTGGGGCCCCTGTCTGGGGTGG - Intronic
1104931278 12:132340690-132340712 TCCCCGGGCCCCTTCTGGGGTGG + Intergenic
1106133400 13:26957804-26957826 TCTGAAGGCGCTCTCTGAGGAGG - Intergenic
1113793104 13:113041128-113041150 TGCGAGGGACATTTCTGGGGTGG + Intronic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1114980594 14:28158512-28158534 TCCTGGTGCCCACTCTGGGGTGG - Intergenic
1119977418 14:79040668-79040690 TCCGGGACCCCTCTCTGTGGTGG - Intronic
1122309658 14:100786389-100786411 TCAGCGGCCCCTCTCTGGGCTGG - Intergenic
1123027809 14:105436589-105436611 CCGGAAGGCCCTCTCGGGGGAGG - Intronic
1123061924 14:105598344-105598366 TCCGAGGGCCCTGAGTGAGGCGG - Intergenic
1123086668 14:105720075-105720097 TCCGAGGGCCCTGAGTGAGGCGG - Intergenic
1123117803 14:105902515-105902537 TCCTCTGGCCCTCTGTGGGGAGG - Intergenic
1125599204 15:40906469-40906491 CCCCAGGGCCCTCTCCAGGGCGG - Intergenic
1126141841 15:45445457-45445479 TCCCAGGCCCCTTTCTGGGCCGG - Intronic
1126643537 15:50852650-50852672 TCCCAGAGGCCTCTCTGGGAGGG + Intergenic
1126801848 15:52305157-52305179 TCCCAGGTCCCTTTCCGGGGTGG + Intergenic
1126802179 15:52309003-52309025 TCCGAGGGCTGTCACTGGGCAGG - Exonic
1127825852 15:62702137-62702159 TGCCAGGACCCTCGCTGGGGCGG + Exonic
1129722419 15:77885165-77885187 CCAGAGGGCCTGCTCTGGGGGGG - Intergenic
1129917194 15:79283885-79283907 TTCGAGAGCCCTTTCTGGCGCGG - Intergenic
1131175825 15:90209090-90209112 TCTGGGGCCCCTCTCTGGGCTGG + Intronic
1132115205 15:99131038-99131060 TCCCAGCGCCCTCTCTGGAGGGG + Exonic
1132448922 15:101954679-101954701 TCTGAGGGGGCTCTCAGGGGTGG - Intergenic
1132709344 16:1259536-1259558 TCCCAGGGCGCTCTCGGCGGGGG - Intergenic
1135115172 16:19717963-19717985 TCCCAGGGCCGGCTCTGAGGCGG + Exonic
1135206909 16:20492166-20492188 ACCTAGGGCCCTCGGTGGGGTGG - Intergenic
1135211976 16:20531466-20531488 ACCTAGGGCCCTCGGTGGGGTGG + Intergenic
1137562815 16:49513821-49513843 TCCGAGAGGCTTCTCAGGGGAGG + Intronic
1141829571 16:86502362-86502384 TCCTCGGTCTCTCTCTGGGGTGG + Intergenic
1141874818 16:86816702-86816724 TCCAAGGGCCCTGTTTTGGGGGG + Intergenic
1141879850 16:86850516-86850538 TCCAAGGTCCCTTTCTGAGGCGG - Intergenic
1142254067 16:89005652-89005674 TCCCAGAGTCCTCTCTGGGGAGG - Intergenic
1143687360 17:8528770-8528792 TCCCTTAGCCCTCTCTGGGGTGG + Intronic
1144670075 17:17127909-17127931 CCCGGGGGCGCTCTCTGCGGGGG + Intronic
1146666794 17:34710494-34710516 TCTGAAGGTCCTCTCTGGGTGGG - Intergenic
1148351420 17:46944403-46944425 TCCCACGTCCCTTTCTGGGGTGG + Intronic
1148666637 17:49379757-49379779 TCCGAGGGCCCTCTCCTGAATGG - Intronic
1150295609 17:64005746-64005768 ACAGAGGGCCCTCTGTGGGAGGG - Intronic
1150336423 17:64333852-64333874 TCAGAGGGGCCTGCCTGGGGAGG + Intronic
1150620434 17:66803790-66803812 TCCGAGGGCCCTCTCTGGGGAGG - Intronic
1152083884 17:78205594-78205616 TCTGAGCGTCCTCCCTGGGGTGG - Exonic
1152299083 17:79485014-79485036 TCTGGGAGCCCTGTCTGGGGAGG - Intronic
1152544448 17:80993700-80993722 GCCGAGTGCCCTCTCTGGGACGG + Intronic
1152715716 17:81899611-81899633 GCCCAGGGGCCTCTCTGAGGAGG - Intronic
1157220505 18:45825662-45825684 TGGGAGGGCCCTCACTGGGGAGG + Exonic
1159020581 18:63139781-63139803 TCCGAGGGCCCTGCCTGTTGTGG + Intronic
1160208626 18:76858517-76858539 TCAGAGGTCCCTATCTGGAGGGG + Intronic
1160437634 18:78863463-78863485 TCCTCTGGCCCTCTCTGGGGAGG - Intergenic
1160636338 19:77874-77896 TCTGAGGGGGCTCTCAGGGGTGG + Intergenic
1160753681 19:747220-747242 TCCCGGGGCCCTCTCTGGCGGGG - Exonic
1161963663 19:7536028-7536050 CCCGAGGGGCCCCTCTTGGGAGG + Intronic
1162015476 19:7844535-7844557 TCAGAAGGACCTCTCTGGGCAGG - Intronic
1162345593 19:10116301-10116323 TCCTCCCGCCCTCTCTGGGGTGG - Intronic
1162376453 19:10308296-10308318 TTCCGGGGCCTTCTCTGGGGTGG + Exonic
1163608776 19:18290538-18290560 CCACAGGGGCCTCTCTGGGGAGG + Intergenic
1165152111 19:33766949-33766971 TCCCAGGTCCCTGTCTGTGGTGG - Intronic
1165950899 19:39473472-39473494 TCCCAGGCCCCACTCTGGGCAGG - Exonic
1166120164 19:40681504-40681526 TCCTAGGGCAGTCTCTGGGCTGG + Intronic
1167235616 19:48312794-48312816 TCCCAGGACCCTCCCTGTGGTGG - Intronic
1167387859 19:49174858-49174880 TCCCAGGGCTCTGTGTGGGGAGG + Intronic
1167645226 19:50702165-50702187 CCTGATGGCCCTTTCTGGGGAGG - Intronic
1167755387 19:51409966-51409988 TCCAAGAACCCTCTCTTGGGGGG - Intergenic
1168687490 19:58357539-58357561 CACGAGGGGCCTCTCTGAGGGGG - Exonic
925390692 2:3491946-3491968 TCCTAGGGCCCTCGCTGGCCAGG + Intergenic
925739547 2:6993589-6993611 TTCCAGGGCCCTCTGTGGAGCGG + Intronic
926117654 2:10223597-10223619 CCAGAGAGCCCTCTCTGTGGTGG + Intergenic
926267885 2:11343696-11343718 TCCGCCTGCCCACTCTGGGGAGG - Intronic
930728817 2:54708958-54708980 TCCGAGGGGTCTCCCAGGGGTGG - Intergenic
936232271 2:110713142-110713164 TCCAAAGTCCCTCTTTGGGGTGG + Intergenic
936517792 2:113193135-113193157 TCTTTGGGCCCTCTCTGGGGAGG + Intronic
937015855 2:118604821-118604843 CCCGAGGGTACTCTGTGGGGGGG - Intergenic
937286684 2:120758475-120758497 ACCGAGGACCCTCTCTTGTGAGG + Intronic
937632456 2:124118730-124118752 TGCGAAGGCCCTCTGTGGGCTGG + Intronic
946495518 2:220192134-220192156 TCCTGGTGCCCTCTCTGGAGAGG + Intergenic
946495726 2:220193380-220193402 TCCTGGTGCCCTCTCTGGAGAGG - Intergenic
948439671 2:237978622-237978644 TCTGAGGGCACCCTCTGGGCTGG + Intronic
948459266 2:238121237-238121259 TCTGAGTGCCCTGTCTGGGCAGG + Intronic
948461279 2:238131072-238131094 GCCGGGGGCCCTCGCTGGGCGGG - Exonic
948892382 2:240913841-240913863 GCCCAAGGCCCTCTCTGCGGCGG + Intergenic
1168838913 20:896390-896412 CCAGATGGCCCTCTCTGGTGGGG - Intronic
1172487194 20:35305375-35305397 TCCGAGGGCCCTCTAGGAAGGGG - Intronic
1172534640 20:35664137-35664159 TCCGAGGTCCATTGCTGGGGAGG - Intronic
1172654718 20:36529766-36529788 TCCCAGGGGGCTCGCTGGGGTGG - Intergenic
1173221602 20:41136950-41136972 TCCGCGCGCCCTCTCCCGGGAGG - Exonic
1174252988 20:49233410-49233432 GCCGAGGGACTTCTCTGTGGCGG + Intronic
1175998377 20:62821363-62821385 TCCTGGTGCCCTCTCTGGGCTGG + Intronic
1176263302 20:64194611-64194633 TCTGAGGGCCCTGTCCTGGGAGG + Intronic
1177112309 21:17043194-17043216 TCTTATGGCCCTCTCTGTGGAGG - Intergenic
1178160319 21:29904851-29904873 CCCAAGGCCCTTCTCTGGGGAGG + Intronic
1183703476 22:39462969-39462991 TCCGGCTGCCCTCTCTGGGCAGG + Intronic
1183924598 22:41197131-41197153 TCTGAGGGCTCTCTCTGAGCTGG + Intergenic
1184216456 22:43070549-43070571 TCCGGGCACCCTCTCTAGGGTGG - Intronic
1184330103 22:43821804-43821826 TCTGAGGGCCCTGGCTGGGGTGG + Intergenic
1184797137 22:46738823-46738845 TCCTAGGGCCAGCTCGGGGGCGG - Intergenic
1184825693 22:46949378-46949400 TCCGAGGGCCCCATCTGTGATGG + Intronic
1185214852 22:49592925-49592947 ACAGAGGGCCCTCCCTGGCGTGG + Intronic
950550772 3:13664556-13664578 CATGAGGGCCCTCTCTGGAGGGG + Intergenic
950967674 3:17157085-17157107 TCCGAGGGACTCCTCTGGGCCGG + Intergenic
954274346 3:49532678-49532700 TCTGAGGGCACTCTCCTGGGTGG - Exonic
954849082 3:53585234-53585256 ACCCAGGGACCTCTCTGGGCAGG - Intronic
961144804 3:124584847-124584869 CCCGAGGTCCCTCTTTGGGGTGG + Intronic
962235283 3:133701677-133701699 TCAGAGAGGCCTCCCTGGGGAGG + Intergenic
968199509 3:196740116-196740138 ACCGAGGCGCCTCGCTGGGGCGG + Exonic
970060885 4:12032943-12032965 TCCTAGTCCCCTCTCTGTGGAGG + Intergenic
975528381 4:75375723-75375745 TCCAAGAACCCTCTCTTGGGGGG + Intergenic
982162977 4:152588409-152588431 TCCCAGGGCCCTCTCTAGCTTGG + Intergenic
982292261 4:153791493-153791515 TCCCAGGGACCAGTCTGGGGAGG - Intergenic
984709445 4:182872998-182873020 ACCGAGGGCCCAGGCTGGGGAGG - Intergenic
986332010 5:6724211-6724233 TACCAGTGCCCTCTCTGTGGGGG - Intronic
988727395 5:33938304-33938326 GCCGAGGACCTTCTCTGGAGAGG + Intergenic
990699791 5:58461817-58461839 TCCCAGGGCCATATTTGGGGTGG + Intergenic
997366060 5:133325793-133325815 TCCCCTGGGCCTCTCTGGGGGGG - Intronic
999879854 5:155850273-155850295 TCCAAGGGCCCTTACTGGGCTGG + Intergenic
1001434499 5:171688734-171688756 TCCCAGGGCCTTCACGGGGGTGG - Intergenic
1001534439 5:172488743-172488765 TTCGAGGGTCCTCAGTGGGGAGG + Intergenic
1002660055 5:180785683-180785705 ACCGAGGGCCTTCCCTGAGGAGG - Intergenic
1004752158 6:18573665-18573687 GCAGAGGGCCCCATCTGGGGTGG + Intergenic
1007180699 6:39927296-39927318 TTCCTGGGCCCTCTCTGGGCTGG - Intronic
1011591613 6:88975527-88975549 TCCGAGGGCATTTTCTGGGGCGG - Intergenic
1011802584 6:91034366-91034388 TAAGAGGGCCCTCAGTGGGGAGG + Intergenic
1019484637 7:1283958-1283980 GACCTGGGCCCTCTCTGGGGAGG + Intergenic
1023905783 7:44520886-44520908 TATCAGGGGCCTCTCTGGGGTGG - Intronic
1024317676 7:48036171-48036193 TCCGCGCGCCCGCTCTGGGTCGG - Intronic
1030502919 7:110382955-110382977 CACGATGGCCCTCTCAGGGGTGG - Intergenic
1034319316 7:150164961-150164983 TCCTGGGGCCCCCTCTGTGGCGG + Intergenic
1034549653 7:151812330-151812352 TCTGTGGGGCATCTCTGGGGAGG + Intronic
1034787429 7:153937815-153937837 TCCTAGGGCCATCCCTGGGCAGG - Intronic
1034885582 7:154795928-154795950 TCTGAGGGCCAGCCCTGGGGTGG - Intronic
1036912067 8:12765912-12765934 TCCGAGGGCCGACTGAGGGGTGG - Intergenic
1037884792 8:22590230-22590252 CCCGAGGGCCCTCACTGCAGGGG - Intronic
1039239754 8:35543742-35543764 TCTCAGGGCCTTCTCTGGGAGGG + Intronic
1045221151 8:100201741-100201763 TGGCAGGACCCTCTCTGGGGAGG - Intronic
1049235550 8:141510607-141510629 TGGGAGGGGCCTTTCTGGGGAGG + Intergenic
1049364872 8:142232335-142232357 GCCGAGGGCCCAGTCTGGGCAGG - Intronic
1049887281 9:36048-36070 TCTGAGGGGGCTCTCAGGGGTGG + Intergenic
1053480973 9:38415921-38415943 TCTGAGGGCCCTCTGAAGGGTGG + Intronic
1056994514 9:91443627-91443649 TCCCAGTGCCCACTCTGGGGTGG - Intergenic
1057245545 9:93451725-93451747 TCCCAGGGCCATGTCTGGGGAGG - Exonic
1059389882 9:113992422-113992444 TCCCAGGGACCTGGCTGGGGTGG + Intronic
1059760203 9:117330387-117330409 TCCGAAGCCCCTCTCTGGATTGG + Intronic
1060211227 9:121711792-121711814 TCAGAGAGCCCTCTGTGGGGAGG + Intronic
1061230719 9:129314262-129314284 TCTGAGGACCCTCTCTAGGTAGG - Intergenic
1062010271 9:134263382-134263404 TCCGAGGGTCCCCTCTGGTTCGG + Intergenic
1062250576 9:135591810-135591832 TCCAAGGACCCTGCCTGGGGAGG - Intergenic
1062397988 9:136360203-136360225 TCCCAAGGCCCCTTCTGGGGTGG - Intronic
1187871318 X:23767228-23767250 TCCTGGAGCCCACTCTGGGGTGG - Intergenic
1189332692 X:40153212-40153234 TCCGGGCCCCCTCTCTAGGGCGG - Intronic
1189479121 X:41379745-41379767 TCCCAGTGCCCCCTCTGGGTTGG + Intergenic
1191016283 X:55813481-55813503 TCCCAGCGCCCACTCTGGGGTGG + Intergenic
1195654275 X:107320247-107320269 TCAGAAGGCCCTTTCTGTGGTGG - Intergenic
1199723135 X:150557579-150557601 CCCCAGGACCCTCTCTGGAGAGG - Intergenic
1200048150 X:153413455-153413477 TCCGAGGCCCCTCACAGAGGTGG + Intergenic
1200229705 X:154437755-154437777 GCTGAGGGCCCACTCTGGCGAGG - Intronic