ID: 1150623566

View in Genome Browser
Species Human (GRCh38)
Location 17:66826110-66826132
Sequence ATGCTCAGTAATGGGATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39248
Summary {0: 7, 1: 549, 2: 15445, 3: 11951, 4: 11296}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150623566 Original CRISPR ATGCTCAGTAATGGGATGGC TGG Intergenic
Too many off-targets to display for this crispr