ID: 1150626367

View in Genome Browser
Species Human (GRCh38)
Location 17:66843783-66843805
Sequence GCCAGCTGTCAGCCTGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 270}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150626365_1150626367 -8 Left 1150626365 17:66843768-66843790 CCTATCTGGAAAGAAGCCAGCTG 0: 1
1: 0
2: 1
3: 25
4: 270
Right 1150626367 17:66843783-66843805 GCCAGCTGTCAGCCTGGTCCTGG 0: 1
1: 0
2: 1
3: 35
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150626367 Original CRISPR GCCAGCTGTCAGCCTGGTCC TGG Intronic
900246446 1:1638344-1638366 GCCAGAGGTCAGCCTGGCCCTGG - Intronic
900257675 1:1705486-1705508 GCCAGAGGTCAGCCTGGCCCTGG - Intronic
900316106 1:2057184-2057206 GACAGCTGTGAGCCTGGAGCCGG - Intronic
901148940 1:7087492-7087514 GGGAGCTGTCAGCCTGGGCTGGG + Intronic
901607291 1:10469285-10469307 GACACCAGTCACCCTGGTCCTGG - Exonic
901953960 1:12770728-12770750 GTCAGCTTTCAGGCTGGGCCAGG + Intergenic
902411199 1:16212520-16212542 TCCAGCTGCCAGCACGGTCCAGG + Exonic
903303148 1:22393173-22393195 CCCAGCCGTCAGCTTGCTCCTGG - Intergenic
904256621 1:29258791-29258813 GTCAGCGGTCAGCCTGTGCCTGG + Intronic
906141685 1:43537484-43537506 GCCAGCTGTCAGCCAGGCGCTGG + Intronic
907948378 1:59156612-59156634 GCCAGCTGTTGGGCTCGTCCAGG + Intergenic
910112737 1:83700250-83700272 AACAGCTGTCAGTCTGGTACAGG - Intergenic
912451613 1:109770787-109770809 GCCACCTCCCAGCCTGGCCCTGG - Intronic
912550646 1:110483298-110483320 GCAAGCTGGCAGCCGCGTCCTGG - Intergenic
912697504 1:111852456-111852478 GACAGCTTCCAGCCTGGTGCTGG + Intronic
912951481 1:114123536-114123558 GCCACCTGCCAGCCTTCTCCAGG - Intronic
914857442 1:151362952-151362974 GCCAGCTGGCACCCTGCACCTGG + Intergenic
919756247 1:201067890-201067912 GCCTGCTCTGAGCCTGTTCCTGG + Intronic
920165369 1:204031841-204031863 GCCAGCTGGCACTCAGGTCCTGG - Intergenic
923124275 1:231021862-231021884 TGCAGCTGTCAGCATGGTCCTGG - Intronic
923595415 1:235357575-235357597 TCCAGGTGTCAGCCAGGTCTGGG + Intergenic
924687686 1:246312139-246312161 GCAAGCAGTCAGCCAGCTCCAGG + Intronic
1063151524 10:3341149-3341171 ACCAGTTGTCAGCCTGGTGCTGG - Intergenic
1063371220 10:5524196-5524218 GTCACCTTTCAGCCTGGTCAAGG - Exonic
1063703009 10:8403926-8403948 GCCAGCTGACAGCCTGCCCCTGG + Intergenic
1063993968 10:11599181-11599203 GTCAGCAGTCAGCATGCTCCAGG - Intronic
1064996275 10:21299513-21299535 GGCAGCTGTCATCCTGGAGCAGG - Intergenic
1065879861 10:30028982-30029004 GCCAGCGGTCAGCCTCCTTCAGG - Exonic
1069193391 10:65519136-65519158 GCCATCTGTGAGCCCGGGCCTGG + Intergenic
1072183719 10:93014199-93014221 GCCAGCTCTGAGCCTGTGCCAGG + Exonic
1072760650 10:98053748-98053770 GCAAGCTCTCAGCCTGGGACTGG + Intergenic
1073012632 10:100373320-100373342 GTCAGCTGCCAGCCAGGCCCGGG - Intergenic
1074596444 10:114872163-114872185 GTCAGATCTCAGCATGGTCCAGG - Intronic
1075089081 10:119433164-119433186 CCCAGCTGCCAGCCTTGTCGGGG + Intronic
1076206779 10:128610153-128610175 GCCTGCTGCCAGCTTGGTCAAGG - Intergenic
1077177185 11:1196267-1196289 GCCACCTGTGGGCCTGGGCCTGG - Intronic
1077239071 11:1501213-1501235 GCCTGCTGTCCCCCTGTTCCGGG - Intronic
1079096912 11:17517008-17517030 TCCAGCACTCAGGCTGGTCCGGG - Intronic
1079349041 11:19677312-19677334 GCAAGCTGTCACCCTGGGCTCGG - Intronic
1081669163 11:44933677-44933699 GCCAGTTGTCAGCCTTTGCCAGG + Exonic
1082835345 11:57647082-57647104 CCCAGCTGTGACCCCGGTCCGGG - Exonic
1083878056 11:65535093-65535115 GCCACCTCCCAGCCTGGGCCTGG - Intronic
1084321088 11:68373681-68373703 GCCAGCTGCCGCCTTGGTCCTGG - Intronic
1088487554 11:110355314-110355336 GCCAGCCCTCAGCATGGACCCGG + Intergenic
1089745799 11:120616013-120616035 GCCAGCAGACAGCTGGGTCCTGG - Intronic
1091122195 11:133065658-133065680 GCCTTCTGTCAGCCTTGCCCTGG + Intronic
1091602795 12:1928195-1928217 GCAAGCTGCCAGCCTGGACCAGG - Intergenic
1091763731 12:3104819-3104841 GCCAGCTGTCAGCTTAGGTCAGG + Intronic
1091875502 12:3930255-3930277 GCCTGCTGTCAGCCTGGAGCTGG + Intergenic
1092926714 12:13278599-13278621 GCCAGCTGCTCGCCTGGCCCAGG + Intergenic
1093953868 12:25194881-25194903 CCTACCTGTCCGCCTGGTCCAGG + Intronic
1095984642 12:47991264-47991286 GGCAGATGTCAGCCTAGTTCTGG - Intronic
1096262586 12:50102436-50102458 CCCAGCTGGCAGCCTGGCACTGG + Intergenic
1102458222 12:113084172-113084194 GCCAGCTGGCAGCCTGGGCCTGG + Intronic
1103402519 12:120652949-120652971 CCCAGCTCTGAGCCTGGTGCAGG - Intronic
1103656596 12:122475877-122475899 TCCAGCTGTCACCCTGCTGCTGG + Intronic
1103731882 12:123033215-123033237 ACCTGCTGTCAGCCTGGCTCTGG - Intronic
1105913185 13:24890397-24890419 GTCAGCTGTGAGCGTGGTCAGGG - Intronic
1107614000 13:42145455-42145477 GCCAGCTGTCAGGATGCTCTCGG + Intronic
1108212061 13:48148992-48149014 CCCAGCTGCCAGCCTGGCACAGG - Intergenic
1112573007 13:100610846-100610868 GCCATCTGTCAGCCTGGGACAGG - Intronic
1113064584 13:106360299-106360321 CCCAGAATTCAGCCTGGTCCTGG + Intergenic
1114616144 14:24069390-24069412 GGCAGTTGTCAGTCTGTTCCTGG - Exonic
1114934402 14:27515547-27515569 GCCTGCTGGCATGCTGGTCCTGG - Intergenic
1115191521 14:30752191-30752213 GCCAGCTGTCACCTTTCTCCTGG + Intergenic
1115687207 14:35808869-35808891 GCCGGCTCCCAGCCGGGTCCCGG + Exonic
1116253943 14:42525351-42525373 TCCAGTGGTCAGTCTGGTCCTGG + Intergenic
1120237054 14:81903934-81903956 GGCTGCTGTCAGCCTGGTGTTGG + Intergenic
1120327417 14:83049074-83049096 GCCAGTTTTCAATCTGGTCCGGG - Intergenic
1121259762 14:92557689-92557711 GCCAGCGGTCCCCCTGGTCTTGG - Intronic
1122849921 14:104522615-104522637 CCCAGCAGCCATCCTGGTCCTGG + Intronic
1124021193 15:25925526-25925548 GACAGCTGGCACCCTGGTACAGG + Intergenic
1124168480 15:27350740-27350762 GCCAGGTGTCTGCCAGGTCTGGG - Intronic
1124434040 15:29633193-29633215 ACCAACTGTCAGCCTTCTCCAGG + Intergenic
1125501517 15:40242668-40242690 GCGAGCAGTCTGCCTGGGCCTGG + Intronic
1126823595 15:52528706-52528728 GCCAGCTGTCAGGCTGGGGAGGG - Intronic
1128153589 15:65377993-65378015 GCGATCTGTCAGCCTCGCCCGGG + Exonic
1130092174 15:80830145-80830167 ACCAGCCATCAGCCTGGACCAGG - Intronic
1130953453 15:88610547-88610569 TCCAGCTGTCAGCCTGAGACAGG - Intergenic
1131143060 15:89993356-89993378 GCCAGCTACCAGGCTGGCCCTGG + Intergenic
1131513926 15:93065293-93065315 GCCAGCTCTCAACCTCCTCCTGG - Intronic
1132142517 15:99407347-99407369 GCACGCTGTCTGCGTGGTCCTGG + Intergenic
1132585288 16:703524-703546 CCCAGCTGTCAGCCAGGCTCTGG - Intronic
1133406026 16:5525179-5525201 GACAGCTGTCAGGGTGGTCCAGG + Intergenic
1134506626 16:14812992-14813014 GCCAGCACTCAGCGTGGTCAAGG - Intronic
1134573929 16:15315829-15315851 GCCAGCACTCAGCATGGTCAAGG + Intergenic
1134728488 16:16440488-16440510 GCCAGCACTCAGCATGGTCAAGG - Intergenic
1134938953 16:18271430-18271452 GCCAGCACTCAGCATGGTCAAGG + Intergenic
1135141888 16:19929013-19929035 GCAAGCTGTCAGCCTGTTTCGGG + Intergenic
1137499458 16:48999126-48999148 GCCAGCTGAGAGCCTGAGCCTGG + Intergenic
1139338189 16:66248286-66248308 GCCAGTTATCAGCCTGATGCCGG + Intergenic
1139911047 16:70397949-70397971 CCCTGCTGCCTGCCTGGTCCAGG + Intronic
1140603657 16:76507852-76507874 GCCAGATGCCATCGTGGTCCAGG - Intronic
1141397183 16:83715707-83715729 GCCAACTGTCAGCCCAGGCCAGG + Intronic
1141714529 16:85719153-85719175 CCCAGCTCTGAGCCTGGGCCAGG + Intronic
1141834953 16:86532354-86532376 GTCTGCTGGCAGCCTGGTTCCGG + Exonic
1142192234 16:88723324-88723346 GCCAGCTGTCGGCCAGCCCCCGG + Exonic
1144744803 17:17606909-17606931 GCCAGCTGTCTGGATTGTCCAGG - Intergenic
1144788820 17:17846368-17846390 GCCAGGTGTCTGGCTGGACCAGG + Intronic
1144849447 17:18236706-18236728 GCACGCTGACAGCCTGGCCCAGG + Exonic
1146942964 17:36856678-36856700 GCCTGCTGTTTGCCAGGTCCTGG - Intergenic
1147350103 17:39835561-39835583 GCATGCTGTCAGCCTTGGCCTGG + Intronic
1149067637 17:52499156-52499178 TCCAGCTGACAGGCTGGTTCTGG + Intergenic
1149460067 17:56821541-56821563 GCCAGCTGGGAGCCTGGTGCTGG - Intronic
1150626367 17:66843783-66843805 GCCAGCTGTCAGCCTGGTCCTGG + Intronic
1151385506 17:73752957-73752979 GCTCGCAGTCAGCCTGGACCTGG - Intergenic
1151681943 17:75626985-75627007 GCCAGCTTCCAGCCTTGCCCAGG - Exonic
1152177945 17:78800257-78800279 TCCAGGTGTCAGGCTGGTCCTGG - Intronic
1152351031 17:79784241-79784263 ACCTGCTGGCAGCCTGGGCCTGG - Exonic
1152646194 17:81469571-81469593 GCCACCTGTGAGCCTCATCCTGG - Intergenic
1152795089 17:82302720-82302742 AGCAGCTGGCAGCCAGGTCCCGG - Intergenic
1153073152 18:1130254-1130276 GCCAGCTGTTAACCTTGTTCAGG + Intergenic
1153852600 18:9110187-9110209 TCCAGTTTTAAGCCTGGTCCTGG + Intronic
1155503934 18:26514688-26514710 GCCAGATGTCACCTAGGTCCAGG - Intronic
1155688233 18:28581987-28582009 GCCAGGGGTCAGCATGGTGCGGG - Intergenic
1157007613 18:43604079-43604101 TCCATCTGTCAGTCTGGTCCTGG + Intergenic
1157524080 18:48365609-48365631 TCCAGGTGTCAGCCTGGGCTGGG - Intronic
1157932002 18:51833477-51833499 GCCAGCTGCTAGCCTAGACCTGG + Intergenic
1158005469 18:52667447-52667469 GCCTGTTGTAAGCCTGTTCCAGG + Intronic
1158475258 18:57774077-57774099 CCCTGCTGTCTCCCTGGTCCTGG + Intronic
1158548494 18:58415852-58415874 GCCTGCCCTCAGCCTGCTCCAGG + Intergenic
1158557897 18:58490386-58490408 CCCTGCTTTCCGCCTGGTCCAGG + Intronic
1160107166 18:75988956-75988978 CCCTGCACTCAGCCTGGTCCAGG + Intergenic
1160586196 18:79914871-79914893 GCCACCTGGCAGCCTGGGCAAGG - Intronic
1160834544 19:1118479-1118501 GCCAGCTGTGGGCCAGGACCTGG + Intronic
1160901102 19:1429144-1429166 GCCGGCTGACAGCCAGCTCCCGG + Intronic
1161101037 19:2422062-2422084 GCCAGCTGTCGTCCTGGGGCTGG - Exonic
1161737726 19:6001912-6001934 GCCAGCTGGCCCACTGGTCCAGG + Exonic
1161970787 19:7578797-7578819 GCTAGCCTTCAGTCTGGTCCAGG + Intergenic
1162128803 19:8513106-8513128 GACAGCTGCCAGCCTGGCCCCGG - Exonic
1162311357 19:9909344-9909366 GACAGCTCTTAGTCTGGTCCTGG + Intronic
1164594475 19:29524800-29524822 TCCAGCAGCCACCCTGGTCCAGG - Intergenic
1164886030 19:31779489-31779511 CCCAGGTGTCAGCCTGCACCAGG + Intergenic
1166766058 19:45252419-45252441 GCCTGGAGTCAGACTGGTCCAGG - Intronic
1167573737 19:50307148-50307170 GCCAGCTGCTTACCTGGTCCCGG - Exonic
925160823 2:1682165-1682187 GGCAGCTGTCAGCATAATCCAGG + Intronic
925628091 2:5862205-5862227 GCCATCTGTGAGGCTGGTCCAGG - Intergenic
925742853 2:7020613-7020635 GCCAGCTGGCACCCTGGCCAGGG + Exonic
925894697 2:8462435-8462457 GCCTGTTGTCACCCTGCTCCAGG + Intergenic
926308115 2:11654602-11654624 GCCTGGGGTCAGCCGGGTCCAGG - Intergenic
926963767 2:18387590-18387612 AAGAGCTGTCAGCCTGGTCCAGG + Intergenic
927194225 2:20536845-20536867 GCCAGCTGAGAGCCAGCTCCAGG - Intergenic
930248964 2:49014049-49014071 GCCAGCTGGCATCCTGATCTTGG + Intronic
933687828 2:85157546-85157568 ACAAGCTGTCAGCATGGCCCTGG - Intronic
934044364 2:88160198-88160220 GCCAACTTTCTGCCTGGTGCAGG + Intergenic
935828671 2:106976745-106976767 GGCAGCTGACAGCCTGCCCCTGG + Intergenic
937243283 2:120476231-120476253 GCCAGCAGCCAGTCTGGTCCTGG + Intergenic
938247990 2:129793803-129793825 GCCAGATCTCAGCCTGTTCATGG + Intergenic
938697035 2:133843782-133843804 GCCTGCTGTCAGCCTGACGCGGG - Intergenic
940171267 2:150832367-150832389 GCCATCTGTGAACCTGGCCCTGG + Intergenic
942088771 2:172467613-172467635 CCCTGCTGTAAGCCTGGTGCTGG - Intronic
946519755 2:220451728-220451750 GCCAGCAGTCAGTTTGGTCAGGG - Intergenic
948699746 2:239752110-239752132 TCCAGGAGTCAGCCTGGGCCCGG - Intergenic
948774738 2:240278237-240278259 GCCATCTGAGAGCCTGGGCCTGG - Intergenic
949076061 2:242058620-242058642 GCCAGTGGTCATCCTGGTCAGGG + Intergenic
1168893700 20:1309766-1309788 GCCACCTGCCAGCCTGGCGCGGG - Intergenic
1168899086 20:1345029-1345051 GCCAGCCTTCAGGATGGTCCCGG + Intronic
1170746685 20:19105847-19105869 TGCAGGTGTCAGCCTGGGCCAGG + Intergenic
1171342782 20:24443733-24443755 CCCAGCAGGCAGCCTGGGCCTGG + Intergenic
1171469743 20:25360812-25360834 TCCAGTTGTCCGCCTGATCCTGG - Intronic
1172949105 20:38710934-38710956 GCCTGGTGACAGGCTGGTCCAGG + Intergenic
1172966712 20:38840630-38840652 GCCATCTGTGAGCCTTTTCCCGG + Intronic
1173582451 20:44157221-44157243 GCCAGCTGTCAGCCCTCTCCAGG + Intronic
1173801596 20:45897878-45897900 GCCAGCTGGCTGCCTGGCTCTGG + Intronic
1173919255 20:46731571-46731593 GCGGGGTGTCAGCCTGGACCTGG + Intronic
1174045315 20:47728934-47728956 GCCAGCTCTCAGGCTGGGCGTGG - Intronic
1174252514 20:49230332-49230354 AGCACCTGTCAGCCTCGTCCAGG - Exonic
1174522478 20:51142297-51142319 TCCAGCTGTCAGGCTTCTCCTGG - Intergenic
1174826376 20:53772341-53772363 CTCAGCGCTCAGCCTGGTCCTGG + Intergenic
1174860321 20:54085233-54085255 GCCAGTAGGCAGCCTGGGCCAGG - Intergenic
1175190107 20:57206049-57206071 CCGAGCTGTCAGACTGGACCTGG - Intronic
1175311164 20:58012415-58012437 TCCAGCTGCCATCCTGCTCCAGG - Intergenic
1175470420 20:59223166-59223188 CCCATCTCTCACCCTGGTCCTGG - Intronic
1176295075 21:5067420-5067442 CCCAGCTCTCAGCCTCTTCCTGG + Intergenic
1178592601 21:33924137-33924159 CACCGCTCTCAGCCTGGTCCAGG + Intergenic
1179048446 21:37868080-37868102 GCCAGCTCTCTGGCTGCTCCGGG + Intronic
1179802569 21:43817859-43817881 GCCTGCTGGCAGCCTCCTCCCGG + Intergenic
1179861974 21:44194708-44194730 CCCAGCTCTCAGCCTCTTCCTGG - Intergenic
1179928128 21:44549868-44549890 CCCAGCTGTAAGCCTGGTGCAGG + Intronic
1181025219 22:20123922-20123944 GCCAGCAGTCATCCTGCACCTGG - Intronic
1181065842 22:20305608-20305630 TCAAGCAGTCAGCCAGGTCCTGG - Intergenic
1182263016 22:29089450-29089472 CACAGCTGCCAGCCTAGTCCAGG + Intronic
1182317015 22:29454386-29454408 GCCTGCTGTGGGCCTGCTCCAGG - Intergenic
1182558868 22:31143411-31143433 CCCAGCTGACACCCTGGCCCTGG - Intergenic
1183899723 22:40996042-40996064 GCCAGCACTCAGCCTGGAGCTGG + Intergenic
1183931171 22:41237058-41237080 GCCAGGTCTCAGCCTGGGCACGG - Intronic
1184032523 22:41903356-41903378 GCCTGCTGTATGCCTGGCCCTGG + Intronic
1184649559 22:45913382-45913404 CCCTGCTCTCAGCCTGCTCCTGG + Intergenic
1185003713 22:48262891-48262913 GGCAGGTGGCAGCATGGTCCCGG + Intergenic
1185194547 22:49460882-49460904 GCGAGGGGTCAGCCTGCTCCAGG - Intronic
949638780 3:6012525-6012547 GACAGCTCTCAGCCTGTTACTGG + Intergenic
950171153 3:10839875-10839897 GCCTGGTGTCAGCCTAGCCCTGG + Intronic
950406992 3:12810905-12810927 TCCAGCTCTCTGCCTTGTCCAGG + Intronic
951456130 3:22894238-22894260 GTCAGCTGTCAGCCCCCTCCGGG + Intergenic
951922269 3:27869823-27869845 GCCTGGTGCCAGCCTGGTTCTGG + Intergenic
954339370 3:49940489-49940511 GCCAGCTGTGAGGCTGGGGCCGG + Intronic
954597263 3:51837126-51837148 GCCAGCCGTTTGCCTGGTCTAGG + Intergenic
954634777 3:52065519-52065541 GCCAGCTGCCTGCCGGGACCTGG + Intergenic
954827949 3:53391544-53391566 GCCAGGCGGCAGCCTGGTCTGGG + Intergenic
956713509 3:72058663-72058685 GCCAGCTGGCAGCCTCCACCGGG - Intergenic
958703708 3:97626276-97626298 GCCAGCCCTCATCTTGGTCCTGG + Intronic
961058713 3:123810544-123810566 GCCAGCTCTAAGCCTGGCCCTGG + Intronic
965728340 3:171744249-171744271 GTCAGCTCTCAGCCTGGCTCTGG + Intronic
967420081 3:189262864-189262886 GCCAGCTGCCAGCAAGGCCCTGG - Intronic
967530812 3:190547365-190547387 GCCATCTGTCAGGATGATCCTGG + Intronic
967889369 3:194354170-194354192 GCCAGGTGTAAGCCTGTCCCAGG - Intergenic
968382462 4:107992-108014 GCCAGCCCTCAGCTCGGTCCCGG + Intergenic
968608694 4:1547182-1547204 GCCAGCTGAGAGCCTGGGGCGGG - Intergenic
968771834 4:2512475-2512497 CACAGCTGTCAGCATGGTCCTGG - Exonic
969332003 4:6479290-6479312 GCCACCTGGAAGCTTGGTCCTGG - Intronic
969402136 4:6962657-6962679 CCCAGCTCTCAGCCTGCTCCAGG + Intronic
969411535 4:7031669-7031691 GTCCGCTGGCAGGCTGGTCCTGG + Exonic
972104274 4:35462460-35462482 TCCAGATGGCAGCCTGGTTCAGG - Intergenic
976115552 4:81722442-81722464 CCCACCTGTCAGCCTCGTCCAGG + Intronic
981167749 4:141581760-141581782 CCCAGCCGTCAGTTTGGTCCAGG - Intergenic
981377106 4:144028378-144028400 GTCAGCTGTCTTCTTGGTCCTGG + Intergenic
981552940 4:145960086-145960108 TCCAGCTGTTGGCCTGGGCCTGG + Intergenic
983938933 4:173522233-173522255 TCCAGCTGCCGGCCTGGCCCAGG + Intergenic
984716540 4:182930844-182930866 CCCACCTGTGAGGCTGGTCCTGG + Intergenic
985009922 4:185571959-185571981 GCCAGCGGTGATCCTAGTCCCGG - Intergenic
985784253 5:1885950-1885972 GCCAGAAGTCAGCCGGCTCCCGG + Intronic
986637423 5:9836757-9836779 GTCAGATCTCAGCCTGCTCCAGG + Intergenic
986693088 5:10330226-10330248 GTCAGATGTCAGCATGGTCCTGG - Intergenic
987071114 5:14337862-14337884 GCCAGCTGCCAGCCCGGGGCAGG - Intronic
987928137 5:24367574-24367596 GCCAGCTGCCAGACTGAACCTGG + Intergenic
987928633 5:24374370-24374392 GCCAGCTGCCAGACTGAGCCTGG + Intergenic
988394764 5:30682650-30682672 GACAGCTGTCAGCCTCCTCTTGG + Intergenic
990965332 5:61440799-61440821 GCCAGCCATGTGCCTGGTCCTGG + Intronic
991613437 5:68471642-68471664 CCCTGCTGTCAGCCACGTCCGGG - Intergenic
995787187 5:115842238-115842260 GCCAGCTGTCAGCCTCCTGGTGG + Intronic
995839495 5:116430235-116430257 TCCAACTGACAGCCTGGGCCTGG + Intergenic
997521134 5:134525387-134525409 GCCTGCTGGCACCCTGGGCCCGG - Intronic
1001745050 5:174086131-174086153 GCCAGCTGGAAGCCAGCTCCTGG + Intronic
1002189410 5:177470943-177470965 CCCAGCTGTAAGCCTGGTGAAGG + Intronic
1004348208 6:14867867-14867889 ACCAGCTCTCTCCCTGGTCCAGG - Intergenic
1005651678 6:27890766-27890788 GCGAGCTGTCTGCTTCGTCCGGG + Exonic
1006515553 6:34543849-34543871 GTCAGCTGTGAGCCTGGGCCAGG - Intronic
1006516595 6:34549025-34549047 GCCAGGTGTCTGCCATGTCCAGG + Intronic
1006714937 6:36111770-36111792 CCCAGCTGCCAGCCAGGGCCTGG - Intergenic
1007108031 6:39296738-39296760 GCCAGAGGTCTGCCTGCTCCTGG + Intergenic
1007719093 6:43874850-43874872 GCCTGTTGTGAGCCAGGTCCTGG + Intergenic
1008086182 6:47247039-47247061 ACCAGCTGTGAGCCTGGTACTGG - Intronic
1011208086 6:84923208-84923230 GCCAGCAGCCAGCCAGGTCAGGG - Intergenic
1015559861 6:134503037-134503059 GCAAGCTGTCTGGCTGCTCCGGG + Intergenic
1015800092 6:137051980-137052002 TCCAGCTGTCAGCCTTTTCAAGG + Intergenic
1016992888 6:149942122-149942144 TCCTGCTGTCCGGCTGGTCCCGG + Exonic
1016996244 6:149964099-149964121 ACCTGCTGTCTGGCTGGTCCCGG + Exonic
1017012582 6:150072497-150072519 TCCTGCTGCCAGGCTGGTCCAGG + Intergenic
1017442808 6:154479399-154479421 GCCAGCTGTCAGCGTGGCTTGGG - Intronic
1017673581 6:156791709-156791731 GCAAGCTTTCTACCTGGTCCAGG + Intronic
1018216842 6:161536557-161536579 GCCAGCTGCCAGCCAGGTGCTGG + Intronic
1019619441 7:1982975-1982997 TCAAGCTGACAGGCTGGTCCTGG + Intronic
1022310141 7:29189478-29189500 GCCAGCTGTAAGCCTGCTCTGGG - Intronic
1026036361 7:66833044-66833066 GACACCTGTCAGCCAAGTCCAGG + Intergenic
1026037436 7:66839956-66839978 GACACCTGTCAGCCAAGTCCAGG + Intergenic
1026504793 7:70973276-70973298 GCCACATGTCAGGCTGGTTCTGG + Intergenic
1026662001 7:72310539-72310561 GCCAGCTCTCAGCCATGTGCTGG + Intronic
1026896592 7:74013221-74013243 GCCAGCGGCCAGCATGGCCCAGG + Intergenic
1026983125 7:74538092-74538114 GACACCTGTCAGCCAAGTCCAGG - Intronic
1027197439 7:76040306-76040328 GCCAGGTCACAGCCTGGTCAGGG - Intronic
1027214234 7:76173695-76173717 GACACCTGTCAGCCAAGTCCAGG - Intergenic
1031984291 7:128153100-128153122 GCCAGCTGGCAGCCTGGATTTGG - Intergenic
1032283314 7:130523579-130523601 GTTAGCTGTCATCCTTGTCCTGG - Intronic
1032285624 7:130536713-130536735 GCTCGCTGTCATCCTTGTCCTGG - Intronic
1033417826 7:141179779-141179801 GCCAAGGGTCAGCCTGGCCCTGG - Intronic
1034312352 7:150099836-150099858 GCCAGCTGTGACCCTGGGCCAGG + Intergenic
1034794503 7:154000828-154000850 GCCAGCTGTGACCCTGGGCCAGG - Intronic
1034874128 7:154710121-154710143 GCCAGATGACAGCTTGGTGCAGG + Intronic
1035243234 7:157545760-157545782 GCCTGCGGTCATCCTGGTCATGG + Intronic
1037750133 8:21676272-21676294 GCCTGGTGTCAGCCTGGTCAAGG + Intergenic
1037891857 8:22627830-22627852 GGCAGCTGCCAGCGTGGTGCAGG - Intronic
1037998137 8:23368261-23368283 GCCAGCTGTCATACTGTGCCAGG + Exonic
1038415181 8:27389794-27389816 GCCAGCATTCTGCCTGCTCCAGG - Intronic
1038643448 8:29345392-29345414 GCCAGCTGGCAGGAAGGTCCAGG - Intronic
1040949381 8:52920842-52920864 GCCACATGTCAGTCTGGTCAAGG + Intergenic
1041367810 8:57127634-57127656 CCCAGCTGTGAGCCTGATGCTGG - Intergenic
1044517883 8:93160596-93160618 ACCTGCTGTCTGCCAGGTCCTGG + Intronic
1044593079 8:93932558-93932580 GCCAGATCTCAGCCTGGCACGGG - Intergenic
1044775036 8:95678562-95678584 GCCTGCTGTCTCCCTGCTCCTGG - Intergenic
1047458386 8:125037903-125037925 GCCAGCTGGCAGTCTGGACCTGG - Intronic
1048569720 8:135641735-135641757 GCCAGCTGTCAGTCAAGGCCTGG - Intronic
1049224399 8:141442772-141442794 CCAAGCTGACAGCCTCGTCCAGG - Intergenic
1049579399 8:143404554-143404576 GCCAGGTGCCAGCCTGGACCTGG - Intergenic
1049605152 8:143525924-143525946 GCCTGCCGTCCGCCTGGGCCTGG + Intronic
1049874435 8:145007224-145007246 GCCAGCTGGCACCCTGATCTTGG - Intergenic
1050924215 9:11242182-11242204 GTCAGCTGTCTGCATGGGCCTGG - Intergenic
1055514974 9:77024417-77024439 GACAGCAGTGAGCCTGGGCCTGG - Intergenic
1059249194 9:112872875-112872897 GCAAGCTGTGAGGCTGGCCCAGG - Exonic
1060886852 9:127160598-127160620 GCCAGCTGCCAGCAGTGTCCTGG + Intronic
1061389463 9:130309596-130309618 CCCAGATCTCAGCCTGGACCTGG + Intronic
1061913435 9:133737215-133737237 CCCAGCTCTCAGGCTGGTCAGGG + Intronic
1062116783 9:134813876-134813898 GCCTGCTGTCTGCCTGCCCCTGG - Intronic
1062426339 9:136507879-136507901 GCCAGCTCCCAGCCAGGGCCTGG + Intronic
1062657526 9:137611983-137612005 GCCACCTCCCTGCCTGGTCCTGG - Intronic
1188421055 X:29991439-29991461 GCCATCTGGGAGCCAGGTCCTGG + Intergenic
1189219127 X:39356035-39356057 CTCAGCTGTCAGCCTTTTCCAGG - Intergenic
1189248396 X:39581032-39581054 GCCAGCTGTCAGTCAGGGCAGGG - Intergenic
1189667714 X:43375327-43375349 TCCAGCTGTCAGCCTTTTCAGGG + Intergenic
1191759361 X:64629931-64629953 GACAGCTCTCAGCCTGTTACTGG + Intergenic
1192175019 X:68880023-68880045 GCCCTCTGCCAGCCTGCTCCTGG + Intergenic
1192266324 X:69540506-69540528 GCCAGGTGTCAGCATGGCCCAGG - Intergenic
1197123000 X:122913967-122913989 GCCTGGGGCCAGCCTGGTCCTGG + Intergenic
1198140004 X:133792873-133792895 GCCAGCTGCCAGAATTGTCCTGG + Intronic
1198792908 X:140364956-140364978 GCAAGGGGTCACCCTGGTCCTGG - Intergenic
1202080888 Y:21083061-21083083 GCCTTCTGTCAGCAAGGTCCAGG - Intergenic
1202124784 Y:21557862-21557884 ACCAGCAGACAGCCTGGCCCTGG - Intergenic
1202154224 Y:21871518-21871540 ACCAGCAGACAGCCTGGCCCTGG + Intergenic