ID: 1150626918

View in Genome Browser
Species Human (GRCh38)
Location 17:66847875-66847897
Sequence CCTTGGTGCTGTGCATCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 345}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150626918_1150626929 18 Left 1150626918 17:66847875-66847897 CCAGCAGATGCACAGCACCAAGG 0: 1
1: 0
2: 2
3: 24
4: 345
Right 1150626929 17:66847916-66847938 GGCACAAGGCATGTCTCTGATGG 0: 1
1: 0
2: 2
3: 25
4: 351
1150626918_1150626922 -3 Left 1150626918 17:66847875-66847897 CCAGCAGATGCACAGCACCAAGG 0: 1
1: 0
2: 2
3: 24
4: 345
Right 1150626922 17:66847895-66847917 AGGCCAGCTCCCTCCTTCCAGGG 0: 1
1: 0
2: 1
3: 27
4: 323
1150626918_1150626924 4 Left 1150626918 17:66847875-66847897 CCAGCAGATGCACAGCACCAAGG 0: 1
1: 0
2: 2
3: 24
4: 345
Right 1150626924 17:66847902-66847924 CTCCCTCCTTCCAGGGCACAAGG 0: 1
1: 0
2: 2
3: 44
4: 429
1150626918_1150626921 -4 Left 1150626918 17:66847875-66847897 CCAGCAGATGCACAGCACCAAGG 0: 1
1: 0
2: 2
3: 24
4: 345
Right 1150626921 17:66847894-66847916 AAGGCCAGCTCCCTCCTTCCAGG 0: 1
1: 0
2: 1
3: 24
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150626918 Original CRISPR CCTTGGTGCTGTGCATCTGC TGG (reversed) Intronic
900295591 1:1947536-1947558 CCTTGCTGCTGACCAGCTGCCGG - Intronic
900404102 1:2484978-2485000 CCTTGGTGTTGAGCATCTTGTGG + Intronic
901192674 1:7421925-7421947 CATCTGTGCTGTGCATCTGCAGG + Intronic
901525759 1:9822887-9822909 CCTTGGTGCTGTTTTTCTGACGG - Intronic
902048969 1:13546914-13546936 CCTGGCTGCTGTGCTCCTGCAGG - Intergenic
902243560 1:15104055-15104077 CCATGGTGCTGTGCTGGTGCTGG + Exonic
902815150 1:18912166-18912188 CCTTGAAGCTGTGTACCTGCTGG - Intronic
902816082 1:18917555-18917577 CCTTCTTGCTGTCCCTCTGCCGG - Intronic
903172553 1:21563103-21563125 CATTGGTGTTGTACGTCTGCAGG - Exonic
903479854 1:23645210-23645232 CCTTGGTCCTGAGCATCTACAGG + Intergenic
906892334 1:49730564-49730586 CCTTGGGGCTCTGCAGTTGCTGG + Intronic
909075536 1:71047296-71047318 CCTTCCTGCTGTGCATCGGCTGG - Exonic
909583657 1:77265378-77265400 CCTGTGTGCTGAGAATCTGCAGG - Intergenic
910398837 1:86818188-86818210 CGTTGGTTCTGTTCATATGCTGG - Intergenic
911792749 1:102039236-102039258 CCTTGGTGATCTGCACCTCCTGG + Intergenic
912569848 1:110613448-110613470 CATAGAGGCTGTGCATCTGCTGG - Intronic
913139919 1:115930962-115930984 CCTTGGTGCTGTTCTTATGATGG + Intergenic
914442226 1:147717828-147717850 CCTTGGTGTTGTGCACCTCCAGG - Intergenic
915001487 1:152597823-152597845 CTCTGGTGGTGTGCCTCTGCTGG + Intronic
915289483 1:154873585-154873607 CCTGAGTGCGGTGCATCTGGAGG - Intergenic
916238436 1:162614012-162614034 CCTGGGTGCCCTTCATCTGCTGG - Intergenic
918418711 1:184339620-184339642 CTTTGGTTCTGTGTATATGCTGG + Intergenic
918817761 1:189211250-189211272 CCTTGGTTCTGTTTATATGCTGG - Intergenic
918823933 1:189297892-189297914 CCTTGGTTCTGTTTATATGCTGG + Intergenic
919254991 1:195109513-195109535 CCTTGGTTCTGTTTATATGCCGG - Intergenic
919308775 1:195878536-195878558 CTTTACTTCTGTGCATCTGCAGG + Intergenic
919415682 1:197306066-197306088 CCTTGGTGCTGTTCGTTTCCAGG - Intronic
920313470 1:205061924-205061946 CGTTGGGGCTGTGCAGCCGCCGG + Exonic
920351071 1:205338418-205338440 CCTTGGCACTTTGCATATGCAGG - Intronic
921777858 1:219123721-219123743 CCTTGGAGATGTGCATATTCCGG + Intergenic
922679495 1:227579932-227579954 CCTTTGGGCTCTGCATCAGCTGG + Intronic
923030914 1:230248501-230248523 ACTTGGTTGTGGGCATCTGCAGG - Intronic
923239246 1:232064372-232064394 CCTTGGTGCTGTGGTGCTGTGGG + Intergenic
923875163 1:238039385-238039407 CTTTGGTTCTGTGTATATGCTGG + Intergenic
924627785 1:245710149-245710171 CCTTGGAGGTGTGCATGTCCAGG - Intergenic
1063093027 10:2884869-2884891 CCTTGGTTCTTCTCATCTGCCGG + Intergenic
1063326810 10:5111804-5111826 CTTTGGTTCTGTGTATATGCTGG - Intronic
1066311940 10:34205881-34205903 CCCTGGGGCTGCGCATCTGATGG + Intronic
1066648076 10:37630396-37630418 CATTGGTTCTGTGGATATGCTGG + Intergenic
1068498597 10:57816505-57816527 TCTTGGTGCTGTGCACTTCCAGG + Intergenic
1069942754 10:71966144-71966166 CCGTGCTGCTGGGCATGTGCTGG + Intronic
1070441221 10:76445446-76445468 CCGTGATGCCCTGCATCTGCAGG - Intronic
1070582649 10:77734189-77734211 CCTTGAGGCTGTGCATCAGCTGG - Intergenic
1072152592 10:92695835-92695857 CCTTGGGGCTCTGCTCCTGCCGG + Intergenic
1072188893 10:93065023-93065045 TCTTGTTGCTGTGGATCTCCTGG + Intronic
1073587213 10:104722250-104722272 CCTTGGTTCTGTTTATATGCTGG + Intronic
1076483780 10:130802569-130802591 CCTGGGTGATGCGCATGTGCAGG - Intergenic
1076548608 10:131262686-131262708 CCTTTGTGCTGTGCATCCTATGG + Intronic
1077463015 11:2720379-2720401 CCTTCGTGCTGAGCATGTGCTGG + Intronic
1077819211 11:5719531-5719553 CCAAGGTGCTGTGCATTTTCTGG + Intronic
1077949583 11:6941593-6941615 CCTTGATGCTCCCCATCTGCAGG - Exonic
1077952456 11:6975166-6975188 CTTTGGTTCTGTTCATATGCTGG + Intronic
1078037767 11:7825276-7825298 CCTTGGTGGAGTGCATCTTCAGG + Exonic
1078098533 11:8315069-8315091 CTTTTGTGCTGAGCCTCTGCAGG + Intergenic
1079372384 11:19862679-19862701 CTATGGAGCTGTGCATCTCCAGG + Intronic
1079848345 11:25498388-25498410 CTTTGGTTCTGTGTATATGCTGG + Intergenic
1080067017 11:28029398-28029420 CTTTGGTTCTGTGTATATGCTGG - Intronic
1080082311 11:28236079-28236101 CTTTGGTTCTGTGTATATGCTGG + Intronic
1080817846 11:35775742-35775764 CTTTGGTGCTGTTTATATGCTGG + Intronic
1080914528 11:36642726-36642748 CTTTGGTTCTGTTCATATGCTGG - Intronic
1081578729 11:44336764-44336786 CCCTGGGGCTGTTCATTTGCAGG - Intergenic
1082141438 11:48614029-48614051 CCTTGGTTCTGTTTATATGCTGG + Intergenic
1082568587 11:54710841-54710863 CCTTGGTTCTGTTTATATGCTGG + Intergenic
1083602547 11:63957963-63957985 GCTTGGTGGTCTGCATCTGCTGG + Intergenic
1083912659 11:65719326-65719348 CCTTGGTGCTGGGCACCAGTGGG - Exonic
1084731547 11:71076756-71076778 CCTATGTCCTGTGCCTCTGCAGG - Intronic
1085718010 11:78890020-78890042 TCTTGCTGCTCTCCATCTGCAGG - Exonic
1085904052 11:80738432-80738454 CCTTGGAGCTGAGCAGATGCTGG + Intergenic
1086064301 11:82730980-82731002 CCTTGGTGCTGTAGAACTGCGGG - Exonic
1086612530 11:88774722-88774744 CCTTGGTTCTGTTCATGTGATGG + Intronic
1089084033 11:115801677-115801699 CTTTGGTGCTAGGCACCTGCTGG - Intergenic
1090315370 11:125782412-125782434 CTTTGGTGCTGTTTATATGCTGG - Intergenic
1090322628 11:125861186-125861208 CTTTGGTGCTGTTTATATGCTGG - Intergenic
1091084247 11:132705242-132705264 CCTTGGTGCTGTTCTTGTGATGG + Intronic
1091675162 12:2483999-2484021 GCTTGGTGCTGAGCATATGTGGG - Intronic
1092706830 12:11294087-11294109 CTTTGGTTCTGTTCATATGCTGG - Intergenic
1094262907 12:28521845-28521867 CATTGGTTCTGTTCATATGCTGG + Intronic
1095483062 12:42655641-42655663 CTTTGGTTCTGTTTATCTGCTGG + Intergenic
1098710095 12:73746733-73746755 CCTTGTTCATGTGCATCTCCTGG + Intergenic
1100148123 12:91702137-91702159 TCTTGCTTCTGTGCATCTCCAGG + Intergenic
1102015362 12:109644702-109644724 CCTTGGAGCTGTGAATGTGTGGG + Intergenic
1102600064 12:114022915-114022937 CCTTGGTGCTGTTCTTGTGATGG - Intergenic
1103462926 12:121119442-121119464 CCTTGGTTCTGCCCACCTGCAGG - Intergenic
1103864548 12:124041692-124041714 CTTTGGTGCTGTCCTGCTGCTGG + Intronic
1104318219 12:127723754-127723776 CCAAGCTGCTGTGGATCTGCAGG - Intergenic
1104388363 12:128370591-128370613 TCTTGGTGCTGTGCCTCTGGTGG - Intronic
1106967215 13:35085452-35085474 CATTGGTTCTGTTCATATGCTGG - Intronic
1110985117 13:81957071-81957093 CCTAGTTGCAGTGCAGCTGCAGG - Intergenic
1110996189 13:82112945-82112967 CCTTGGTTCTGTTCATATGCTGG - Intergenic
1111694502 13:91606227-91606249 CTTTGGTTCTGTTCATATGCTGG + Intronic
1111874162 13:93872558-93872580 CCTTGGCCCTGTCCAGCTGCTGG + Intronic
1112625290 13:101097007-101097029 GCTTGATGCTGGGCTTCTGCTGG - Intronic
1113738523 13:112695146-112695168 CCTTGCTGTTGTTCAGCTGCTGG + Intronic
1114523572 14:23353531-23353553 CATTGGTGCTGAGCATGGGCAGG + Intergenic
1114932750 14:27494158-27494180 CTTTGGTTCTGTTCATATGCTGG - Intergenic
1115096851 14:29648025-29648047 TCTTCTTGCTGTGCAGCTGCAGG - Intronic
1116162360 14:41285381-41285403 CATTGGAGCTGTCCATCTGGTGG - Intergenic
1116398262 14:44473447-44473469 CTTTGGTTCTGTGCATATGCTGG + Intergenic
1119175317 14:72564328-72564350 CCTCTGTGCTGAGCATGTGCAGG - Intronic
1120204713 14:81575130-81575152 ACTTGGTGAGGTGCACCTGCTGG - Intergenic
1121518489 14:94569782-94569804 CCCTGGTGCTGTGCAGCCTCTGG + Exonic
1125086674 15:35738491-35738513 GCATGGTGGTGTGCATCTGTGGG + Intergenic
1127223345 15:56903891-56903913 CTTTGGTGCTGTTTATATGCTGG + Intronic
1127507318 15:59609924-59609946 CCGTGGTGCTGAGCAGCAGCAGG + Intronic
1128803956 15:70516991-70517013 CCTTGGTGCAGGCCACCTGCTGG - Intergenic
1128809185 15:70557675-70557697 CACTGCTGCTGTGCAGCTGCTGG - Intergenic
1132380584 15:101363192-101363214 CCATGGAACTGTGCCTCTGCAGG - Intronic
1133359195 16:5160465-5160487 GCATGGTGATGTGCATCTGTAGG + Intergenic
1133514002 16:6489752-6489774 CCCAGGTGAAGTGCATCTGCAGG - Intronic
1134332447 16:13263395-13263417 CCTTGGTGCTGTTCTTGTGATGG + Intergenic
1135102268 16:19616421-19616443 CCTTGCTTCTGAGCATCTGCTGG + Intronic
1135949559 16:26901393-26901415 CCTTGGCACCTTGCATCTGCCGG - Intergenic
1136381085 16:29896099-29896121 CCATGGTGATGTGCACCTGTGGG - Intronic
1136914921 16:34178857-34178879 CTTTGGTTCTGTGTATATGCTGG - Intergenic
1137619095 16:49864688-49864710 CCTAAGTTCTGAGCATCTGCAGG - Intergenic
1138230633 16:55333177-55333199 CCTGGTTGCTGTGCAGCTGAGGG - Intergenic
1141867651 16:86761735-86761757 GCTGGGTGCCGTGCATCTGGTGG + Intergenic
1142273649 16:89104385-89104407 CTTTAGGGCTGTGCCTCTGCTGG - Intronic
1144518423 17:15937445-15937467 CTTTGGGGCTGTGCATAAGCAGG - Intergenic
1145250422 17:21294146-21294168 CCTTGTTGCTGTCCCTCTGAGGG + Intronic
1147894546 17:43742025-43742047 GCATGGTGCTGGGCATCTGCTGG + Intergenic
1147939394 17:44035240-44035262 CCTTTCTCCTGTGCCTCTGCAGG - Exonic
1149530618 17:57392038-57392060 CCAGGCTGCTCTGCATCTGCAGG - Intronic
1150066579 17:62115084-62115106 CCTTGTTGCTGTATATCTGTAGG - Intergenic
1150566413 17:66345025-66345047 CCTTGATTCTGAGCATATGCAGG - Intronic
1150626918 17:66847875-66847897 CCTTGGTGCTGTGCATCTGCTGG - Intronic
1150994757 17:70304494-70304516 CCTGGTTGCTGTGCAACTTCTGG + Intergenic
1151007315 17:70452721-70452743 CCTTGGTGCTGTGCATTCTGTGG - Intergenic
1151877511 17:76875308-76875330 CCTTGGTGCTGTTCTTGTGATGG + Intronic
1152508530 17:80769904-80769926 GGTAGGTGCTGTGCAGCTGCAGG + Intronic
1153550619 18:6258289-6258311 CGCTGAGGCTGTGCATCTGCAGG + Intronic
1155664842 18:28296169-28296191 CCTTGGTTCTGTTTATATGCTGG + Intergenic
1155930400 18:31701208-31701230 CCTTGGTGCTGTTCTTGTGGTGG + Intergenic
1156395069 18:36691827-36691849 CCTCGGTGCCTTGCATTTGCAGG - Intronic
1156401832 18:36746215-36746237 CATGTGTGATGTGCATCTGCTGG + Intronic
1157076721 18:44474956-44474978 TGTTGGTGCTGTGCCTCTCCAGG + Intergenic
1157659211 18:49424266-49424288 CCTTGGTTCTGTGTATATGATGG - Intronic
1157692754 18:49697367-49697389 CCTTACTGCTGTGCATCTGCGGG + Intergenic
1157819116 18:50752482-50752504 CCTTGGGGTTATGCACCTGCAGG + Intergenic
1158332437 18:56377384-56377406 CCTTGCTGCTTTGCATTAGCAGG - Intergenic
1158615293 18:58981527-58981549 CCTTGATGCCATGCATCAGCTGG - Exonic
1158726650 18:59979636-59979658 CCTTACCGCTATGCATCTGCTGG + Intergenic
1161436509 19:4266840-4266862 CCATGGTGGCGTGCACCTGCAGG + Intronic
1162584283 19:11549633-11549655 CCTTGTTGCTGCCCATCTGCAGG - Exonic
1164998397 19:32740453-32740475 CCTGGGTACTCTGCATCTCCTGG + Intronic
1165299096 19:34956809-34956831 TCTCCGTGCTGTGCATCTGAAGG - Exonic
1165367879 19:35380661-35380683 TCTTGGTGCTGGAGATCTGCAGG + Intergenic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
928765368 2:34639178-34639200 CTTTGGTTCTGTTTATCTGCTGG - Intergenic
929068672 2:38006977-38006999 CCTTGGTTCTGTTTATATGCTGG + Intronic
930234612 2:48876770-48876792 TCCTGGAGCTTTGCATCTGCAGG - Intergenic
930262344 2:49162343-49162365 CCTTGGTGGTATTCATCTGATGG + Intergenic
930983701 2:57559284-57559306 CTTTGGTTCTGTTTATCTGCTGG - Intergenic
931976171 2:67646568-67646590 CCTTGGGGCTCTGCAGTTGCTGG - Intergenic
932642601 2:73464314-73464336 CTTTGGTTCTGTGTATATGCTGG - Intronic
932715870 2:74100507-74100529 ACTCGGTGCTGGGCAACTGCCGG + Exonic
935389602 2:102536467-102536489 CCTTGATGCTGTGATGCTGCTGG + Intergenic
936159150 2:110070910-110070932 CATGGCTGCTGAGCATCTGCTGG - Intergenic
936185511 2:110300422-110300444 CATGGCTGCTGAGCATCTGCTGG + Intergenic
936300318 2:111299947-111299969 CCATTCTGCTGAGCATCTGCAGG + Intergenic
938236803 2:129712062-129712084 CCAGGGTGCACTGCATCTGCTGG - Intergenic
940433939 2:153628618-153628640 CTTTGGTTCTGTTCATATGCTGG + Intergenic
941124309 2:161567490-161567512 CTTTGGTTCTGTTTATCTGCTGG - Intronic
943174408 2:184451703-184451725 GCTTGGTCCTTTCCATCTGCTGG + Intergenic
943217646 2:185059134-185059156 CCTTGGTTCTGTTTATATGCTGG - Intergenic
945204536 2:207318241-207318263 CCTGGGAGCTTTGCATTTGCTGG - Intergenic
946362603 2:219228467-219228489 CCTCGATGCTCTGCAGCTGCTGG + Exonic
947834960 2:233168822-233168844 CCCAGGTGATGTGCAGCTGCTGG + Intronic
948122838 2:235543737-235543759 CCTCGGGCCTGTGCATCTGTAGG + Intronic
948343609 2:237276813-237276835 CCTTGGTGCTGTTCTTCTAATGG - Intergenic
948480824 2:238249440-238249462 CCTGGGAGCTGCGTATCTGCAGG + Intronic
948508364 2:238446577-238446599 CCTGAGTGCTGTGCTGCTGCTGG + Exonic
1169877884 20:10317750-10317772 CCGTGGTGCTGTACTACTGCAGG - Intergenic
1169913772 20:10668050-10668072 CATTGGTGCAGTGCGTGTGCTGG - Intronic
1170803512 20:19610403-19610425 GCTTGGGGCTGTGCATCTGTGGG - Intronic
1171281104 20:23899124-23899146 CCTTGGTTCTGTTTATATGCTGG + Intergenic
1173289522 20:41702135-41702157 CATTGGTGGGGTGCATCTCCAGG + Intergenic
1174415481 20:50363578-50363600 GCTTGGTGCAGTCCAGCTGCTGG - Intergenic
1178320979 21:31605440-31605462 CCTTGGTGCTGTTCTCCTGACGG + Intergenic
1179094467 21:38299909-38299931 CCTTGGTGACGTGGGTCTGCAGG - Exonic
1180045549 21:45303462-45303484 CCATGGAGCTGAGCATCAGCTGG + Intergenic
1180210980 21:46295443-46295465 CCTTGGTGCTGTGCCTGCTCAGG + Intronic
1180709599 22:17830874-17830896 CCTGGGAGCTGTGCAGCTCCAGG - Intronic
1180993732 22:19954041-19954063 CCCTGGGGCTGTGAATCTGCAGG + Intronic
1181187653 22:21118376-21118398 CCTTGGTGCTGGGGGTCTGGTGG - Intergenic
1181211545 22:21292117-21292139 CCTTGGTGCTGGGGGTCTGGTGG + Intergenic
1181396800 22:22628755-22628777 CCTTCGTGCTGAGCAGGTGCAGG + Intergenic
1181397962 22:22634770-22634792 CCTTGGTGCTGGGGGTCTGGTGG - Intergenic
1181499493 22:23307803-23307825 CCTTCGTGCTGAGCAGGTGCAGG + Intronic
1181651444 22:24261288-24261310 CCTTGGTGCTGGGGGTCTGGTGG + Intergenic
1181704923 22:24644313-24644335 CCTTCGTGCTGAGCAGGTGCAGG + Intergenic
1181705932 22:24649451-24649473 CCTTGGTGCTGGGGGTCTGGTGG - Intergenic
1182130663 22:27848084-27848106 CTTTGGTGCTGTGCCCCTTCTGG - Intergenic
1183442776 22:37832642-37832664 CTTTGGTACTGGTCATCTGCAGG + Exonic
1184510331 22:44929686-44929708 CCTTTGTGCCGGGCATCTCCTGG - Intronic
1184924493 22:47627339-47627361 CCCTGGAGCTGTGCCTCAGCTGG - Intergenic
1185042317 22:48511391-48511413 TCCTGGGGCTGTGCGTCTGCAGG + Intronic
1203215405 22_KI270731v1_random:3315-3337 CCTTGGTGCTGGGGGTCTGGTGG - Intergenic
1203275222 22_KI270734v1_random:82077-82099 CCTTGGTGCTGGGGGTCTGGTGG + Intergenic
950635301 3:14310165-14310187 CCTTGGTGCTGTGCATTCTGTGG - Intergenic
950799810 3:15541269-15541291 CCTTGGTGCTGTTCACATGATGG - Intergenic
950840880 3:15967173-15967195 CCTTGGTGCTGTGTGTCGGCTGG + Intergenic
953805552 3:46064753-46064775 CCTTGGTGCTGTTGAGCTGGTGG - Intergenic
953967695 3:47322658-47322680 CTTTGATGCTCTGCAGCTGCAGG - Exonic
954968188 3:54629196-54629218 CCTTGCTGCTGTTGGTCTGCAGG + Intronic
955667509 3:61366151-61366173 CCTTGGTTCTGTTTATATGCTGG - Intergenic
955732995 3:62007110-62007132 CCTCTGTGCTGTGGCTCTGCAGG + Intronic
955865631 3:63380771-63380793 CTTTGGTTCTGTGTATATGCTGG - Intronic
957399152 3:79686091-79686113 CCTTGGTTCTGTTTATATGCTGG - Intronic
958600342 3:96288917-96288939 TCTTGGCTCTGTGCACCTGCAGG - Intergenic
959509082 3:107189423-107189445 CCTGGGCCCTGTGCCTCTGCTGG + Intergenic
959934310 3:112013476-112013498 CCTTGTTGCTGCCCATCTGCAGG - Exonic
960036326 3:113106076-113106098 TCTTGGTGCTTTGCCTCAGCAGG - Intergenic
961386888 3:126527752-126527774 CCATGCTGCTGTCCATCTTCAGG + Intronic
961442935 3:126963435-126963457 CCTTGGCTGTGTGCCTCTGCTGG - Intergenic
961828445 3:129611151-129611173 CCTGGAGGCTGTGCAGCTGCAGG - Intergenic
962524814 3:136228148-136228170 CTTTGGTTCTGTTCATATGCTGG - Intergenic
962548939 3:136468855-136468877 CTTTGGTTCTGTTCATATGCTGG - Intronic
962553737 3:136524867-136524889 CTTTGGTTCTGTTCATGTGCTGG + Intronic
962697888 3:137968992-137969014 CCTTGGTTCTGTTTATATGCTGG - Intergenic
963975784 3:151479066-151479088 TCTTGCTGCTATGCATTTGCAGG - Intergenic
964176733 3:153832611-153832633 CCTTGGTGCTGTTCTCCTGATGG - Intergenic
964587775 3:158326502-158326524 CTTTGGTTCTGTGTATATGCTGG + Intronic
964807040 3:160621652-160621674 CATTGGTGCTATGTATGTGCAGG + Intergenic
965013721 3:163129470-163129492 CCCTGGTGCTGTGCTCCTTCAGG - Intergenic
965228571 3:166023372-166023394 CCTTGGTTCTGTTTATATGCTGG + Intergenic
965464108 3:169005782-169005804 CCTTGGTTCTGTTTATATGCTGG + Intergenic
966985919 3:185180328-185180350 CCTTGCTGCTGTGACTGTGCAGG + Intergenic
967749852 3:193101425-193101447 CCTGACTTCTGTGCATCTGCAGG - Intergenic
969008355 4:4040078-4040100 GCATGGTGATGTGCATCTGTAGG + Intergenic
969526312 4:7705875-7705897 CCTGGGAGCTGTGCGCCTGCTGG - Intronic
969804621 4:9597320-9597342 GCATGGTGATGTGCATCTGTAGG - Intergenic
970990510 4:22208158-22208180 CGTTGGTTCTGTTCATATGCTGG - Intergenic
975036982 4:69696371-69696393 CTTTGGTTCTGTTCATATGCTGG + Intergenic
975214093 4:71734008-71734030 CATTGGTTCTGTTCATATGCTGG - Intergenic
976058597 4:81099431-81099453 CCTTGGTTCTGTTTATATGCTGG - Intronic
976195418 4:82527390-82527412 ACTTGGTGTGGGGCATCTGCTGG + Intronic
976550463 4:86389103-86389125 CTTTGGTGCTGTTCTCCTGCTGG + Intronic
977515866 4:98020290-98020312 CTTTGGTTCTGTTCATATGCTGG + Intronic
978226233 4:106338528-106338550 CCTCAGTTCTGTGCCTCTGCAGG - Intronic
979356516 4:119712255-119712277 CTTGGCTTCTGTGCATCTGCAGG - Intergenic
979800011 4:124896746-124896768 CTTTGGTTCTGTTCATATGCTGG - Intergenic
980971198 4:139568765-139568787 TCTGCATGCTGTGCATCTGCAGG - Intronic
981419890 4:144537219-144537241 CCCTTGTGCTGTTAATCTGCTGG - Intergenic
982902818 4:161028661-161028683 CCTTGGTTCTGTTTATATGCTGG - Intergenic
984574896 4:181436630-181436652 CGTTGGTTCTGTTCATATGCTGG + Intergenic
984788293 4:183590142-183590164 AGTTGGTGCTGTTCACCTGCGGG - Intergenic
984872018 4:184334048-184334070 CCTTGGTGCTGCTCTTGTGCTGG - Intergenic
985020918 4:185689461-185689483 CCTTTGTGTGGTGCATATGCAGG + Intronic
985766483 5:1782283-1782305 CCTTGGTGCTGTGTCTCAGCAGG + Intergenic
985945655 5:3180770-3180792 CCCTTGTCCTGGGCATCTGCCGG + Intergenic
985978552 5:3442768-3442790 CTTTGGTTCTGTTTATCTGCTGG - Intergenic
986082489 5:4409328-4409350 CCTTTGTGCTGACCATTTGCTGG - Intergenic
986541331 5:8847383-8847405 CCTTATTTCTGTGCTTCTGCTGG + Intergenic
986655445 5:10006550-10006572 CCTTGGTTCTGTTTATATGCAGG - Intergenic
987289412 5:16494469-16494491 CCTTGGTGCTGTGCTCATGATGG + Intronic
988530337 5:32021971-32021993 CCTTGGTTGTGGGCACCTGCAGG - Intronic
989465138 5:41746270-41746292 CCTTGGTTCTGTTTATATGCTGG - Intronic
989493294 5:42082016-42082038 CCTTGGTTCTGTTTATATGCTGG - Intergenic
990528646 5:56652891-56652913 TCTTGGTGCTGTGCATTTTATGG - Intergenic
991544020 5:67761404-67761426 CCTTGGTTCTGTTTATATGCTGG - Intergenic
992336134 5:75771820-75771842 CTTTGGTTCTGTTCATATGCTGG + Intergenic
994589339 5:101754424-101754446 CCTTGGGGCTTTGCAACGGCTGG + Intergenic
997630810 5:135367727-135367749 CCTTGGTGCTGAGGACCAGCAGG - Intronic
998399573 5:141841593-141841615 CCCTGCTGCCCTGCATCTGCTGG + Intergenic
998442457 5:142173915-142173937 CCTTGGTGCTGTTCTCCTGATGG - Intergenic
998931324 5:147184623-147184645 CTTTGGTTCTGTGTATATGCTGG - Intergenic
1000253382 5:159515985-159516007 CCTTCGTCCTGAGCAGCTGCAGG + Intergenic
1000708152 5:164537216-164537238 CCTTGGTTCTGTTTATATGCTGG - Intergenic
1001157328 5:169284128-169284150 CCTTGCTGCTGTGCAGCCGTGGG - Intronic
1001267683 5:170286665-170286687 CTTTGGTGCTGTCTATCTCCAGG - Intronic
1001394803 5:171409934-171409956 GCTTGGTGGTGTGCAACTACAGG - Intronic
1001634833 5:173202475-173202497 CCTGGCTGCTTTGCATGTGCTGG + Intergenic
1002429280 5:179193801-179193823 CCTTGGTGGTGTGTCTCAGCAGG - Intronic
1002979704 6:2124499-2124521 CCATTGTGCTGTTTATCTGCTGG - Intronic
1004449718 6:15734074-15734096 CCTCAGTGCTGTGCTTCTGGAGG - Intergenic
1005993903 6:30920415-30920437 CCATGGTACTGCCCATCTGCAGG + Exonic
1007416851 6:41696009-41696031 CCCTGGCTCTGTGCCTCTGCTGG - Intronic
1008604020 6:53122800-53122822 CCTGGGTGCTGTGCTTATGTGGG - Intergenic
1009348466 6:62646283-62646305 CTTTACTTCTGTGCATCTGCAGG - Intergenic
1009527389 6:64764309-64764331 CTTAGCTTCTGTGCATCTGCAGG + Intronic
1009579500 6:65513659-65513681 CTTTGGTTCTGTTCATATGCTGG - Intronic
1010407368 6:75520322-75520344 CATTTATGCTGTGCATCAGCTGG + Intergenic
1011081972 6:83499504-83499526 CTTTGGTTCTGTGTATATGCTGG - Intergenic
1012003274 6:93681105-93681127 CCATGGTGCTGGGCTGCTGCTGG + Intergenic
1012220360 6:96641512-96641534 CCTTGGTTCTGTTTATGTGCTGG - Intergenic
1012325051 6:97906379-97906401 CTTTGGTTCTGTGTATATGCTGG + Intergenic
1012863887 6:104595111-104595133 GCATTGTGGTGTGCATCTGCAGG + Intergenic
1016683092 6:146853017-146853039 CCTTGGTGCTGTTCTTGTGGTGG - Intergenic
1018203643 6:161416870-161416892 CCTGGGTGCTCAGCATCTGCTGG - Intronic
1018464835 6:164034342-164034364 CGTTGGTTCTGTGTATATGCTGG + Intergenic
1018552906 6:165018713-165018735 CCTTGGTTCTGTTTATATGCTGG + Intergenic
1018796721 6:167191623-167191645 CCTTGGTGCTCTCCATCTGCCGG + Intronic
1018819602 6:167363507-167363529 CCTTTGTGCTCTCCATCTGCCGG - Intronic
1020328817 7:6997867-6997889 GCATGGTGATGTGCATCTGTAGG + Intergenic
1020598842 7:10247678-10247700 CCTTTGTCCTGTGCAGCTCCTGG - Intergenic
1020640750 7:10750938-10750960 CTTTGGTTCTGTTCATATGCTGG - Intergenic
1020645321 7:10808173-10808195 CTTTGGTTCTGTTCATATGCTGG + Intergenic
1020746950 7:12090752-12090774 CATTGGTGCTGTGCACTTCCAGG - Intergenic
1020844960 7:13270961-13270983 CTTTGGTTCTGTTTATCTGCTGG + Intergenic
1022416170 7:30178966-30178988 CCTTGGTGCTGAGCAAATGGTGG + Intergenic
1024265529 7:47603432-47603454 GCGTGGTGGTGTGCACCTGCGGG + Intergenic
1025255074 7:57379189-57379211 ACTTGGTGCAGTCCAGCTGCTGG + Intergenic
1027810558 7:82891808-82891830 CGTTGGTTCTGTTCATATGCTGG + Intronic
1027918563 7:84359411-84359433 CCTTGGTTCTGTTTATATGCTGG + Intronic
1028426851 7:90699268-90699290 CCTGGGTCCTGTACTTCTGCAGG - Intronic
1028666365 7:93348144-93348166 CCTGGATGCAGTGCAACTGCAGG + Intronic
1029552297 7:101243898-101243920 CCTTGGTGCAGTAAATCTACCGG + Intronic
1029703780 7:102264797-102264819 GCTTTGTGCTGTGGATCTTCTGG + Intronic
1030477921 7:110060998-110061020 CTTTGGTGCTGTTTATATGCTGG + Intergenic
1030997383 7:116375105-116375127 CCTTGGTTCTGTTTATATGCTGG - Intronic
1031515373 7:122692462-122692484 CCTTAGTGCTGTGCAGTTCCTGG + Intronic
1032275068 7:130447183-130447205 CCTTGGTGGTGTACATTTGCAGG + Intergenic
1033670541 7:143488707-143488729 CCTGGGTGGAGTGGATCTGCAGG + Intergenic
1034681370 7:152931011-152931033 CCTTGGTGCTGTTCTTGTGATGG - Intergenic
1034821845 7:154223219-154223241 CCCTGGTGCTGAGCTTCTGCTGG - Intronic
1035202513 7:157276505-157276527 ACTTGGTGCAGAACATCTGCTGG - Intergenic
1035597084 8:866662-866684 CCTGGGAGCTGTGCAGCTTCTGG + Intergenic
1035741960 8:1935341-1935363 TCTTGGTGCCGTGCTTCTGTGGG + Intronic
1035757120 8:2042939-2042961 CCTGGGTGAGGTGCACCTGCAGG - Intergenic
1036249641 8:7150756-7150778 GCATGGTGATGTGCATCTGTAGG + Intergenic
1036367811 8:8136292-8136314 GCATGGTGATGTGCATCTGTAGG - Intergenic
1036752711 8:11453560-11453582 ACAGGGAGCTGTGCATCTGCTGG - Intronic
1036883072 8:12529369-12529391 GCATGGTGATGTGCATCTGTAGG + Intergenic
1036932876 8:12973297-12973319 CCACGATGCTGTGCATGTGCTGG - Intronic
1037149327 8:15616759-15616781 CCTTGGTGCTCTGCCGTTGCTGG + Intronic
1037594605 8:20344423-20344445 CCTGCATGGTGTGCATCTGCTGG + Intergenic
1037708779 8:21338664-21338686 CCTTGGTTCTGTTTATATGCTGG + Intergenic
1038532650 8:28331090-28331112 GCTTGGTGCTTTGGGTCTGCTGG - Intronic
1038790680 8:30665626-30665648 GCTTGGTGGTGTGCGTCTGTAGG - Intergenic
1039238017 8:35524203-35524225 CCTTTCTCCTGTGCCTCTGCAGG - Intronic
1040357161 8:46629978-46630000 CTTTGGTTCTGTTCATATGCTGG + Intergenic
1043218052 8:77620887-77620909 CCTTGGGGCTCTGCGTTTGCTGG - Intergenic
1043662220 8:82758190-82758212 CCTTGGGGCTCTGCAGTTGCTGG - Intergenic
1045386380 8:101674927-101674949 CCTTGGTTCTGTTTATATGCTGG - Intergenic
1049781534 8:144431213-144431235 CCTGGGTGTGGTGCACCTGCTGG - Intronic
1050119669 9:2295535-2295557 CCTCTGTGCTTTGCAACTGCAGG + Intergenic
1052563069 9:30110597-30110619 CCTTGGTTCTGTTTATATGCTGG - Intergenic
1052725849 9:32227317-32227339 CTTTGGTTCTGTTCATATGCTGG + Intergenic
1053568382 9:39277644-39277666 CTTTGGTTCTGTGTATATGCTGG - Intronic
1054128761 9:61341366-61341388 CTTTGGTTCTGTGTATATGCTGG + Intergenic
1059675365 9:116533633-116533655 CATTGGTTCTGTTCATATGCTGG + Intronic
1061499198 9:130992569-130992591 GCTTGCTGCTGTGCGGCTGCAGG - Intergenic
1061594858 9:131622198-131622220 CATTGGTGTTGCGCGTCTGCCGG - Intronic
1062288609 9:135784754-135784776 CCTCGGTGATTTTCATCTGCAGG - Exonic
1062674398 9:137731985-137732007 CCTTGGGGCTCTGCAGTTGCTGG - Intronic
1203440730 Un_GL000219v1:5652-5674 CTTTGGTTCTGTTCATATGCTGG + Intergenic
1203511608 Un_KI270741v1:124035-124057 CTTTGGTTCTGTTCATATGCTGG + Intergenic
1186349356 X:8727529-8727551 CCTGGGAGCTGCCCATCTGCTGG + Intronic
1188703170 X:33291126-33291148 CATTGGTGCTGTTTATGTGCTGG - Intronic
1190590317 X:51993574-51993596 CCTTGGTTCTGTTTATATGCTGG + Intergenic
1190683078 X:52845753-52845775 CCTTGGTTCTGTTTATATGCTGG + Intergenic
1190971691 X:55356338-55356360 CCTTTGCCCTGTGCAGCTGCTGG - Intergenic
1191145386 X:57160110-57160132 CGTTGGTGCTGTTTATATGCTGG + Intergenic
1191202893 X:57803527-57803549 CCTGACTTCTGTGCATCTGCAGG - Intergenic
1191948924 X:66566946-66566968 CATTGGTTCTGTTTATCTGCTGG - Intergenic
1191968842 X:66791316-66791338 CCTTGGTTCTGTTTATATGCTGG + Intergenic
1192827721 X:74715815-74715837 CTTTGGTTCTGTTCATATGCTGG - Intergenic
1193002320 X:76576723-76576745 CTTTGGTTCTGTGTATATGCTGG + Intergenic
1193369199 X:80673204-80673226 CTTTGTTACTTTGCATCTGCGGG + Exonic
1193607223 X:83583537-83583559 CCTTGTTGCTGATCATCTGGGGG + Intergenic
1194009142 X:88536624-88536646 CCTTGGTTCTGTTTATATGCTGG + Intergenic
1194458125 X:94129878-94129900 CCTCAGAGCTGTGAATCTGCTGG - Intergenic
1195987097 X:110642290-110642312 CATTGGTTCTGTTCATTTGCTGG + Intergenic
1196325534 X:114397925-114397947 CCTTGGTTCTGTTTATATGCTGG - Intergenic
1199431467 X:147765491-147765513 TCTTGGTGCTGTTCTTCTGGTGG + Intergenic
1199716756 X:150512269-150512291 CCTTGGGACTCTGCATATGCTGG - Exonic
1200014380 X:153147448-153147470 ACTGGGTTCTGTGCATGTGCTGG + Intergenic
1200025222 X:153252506-153252528 ACTGGGTTCTGTGCATGTGCTGG - Intergenic
1201171455 Y:11270273-11270295 CCTTGGTCCTGTTTATATGCTGG + Intergenic
1201759240 Y:17519217-17519239 CCTTGGAGCTGAACGTCTGCTGG + Intergenic
1201842315 Y:18386773-18386795 CCTTGGAGCTGAACGTCTGCTGG - Intergenic