ID: 1150629887

View in Genome Browser
Species Human (GRCh38)
Location 17:66872169-66872191
Sequence CAGTCTGTGAATTTTGTATA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150629881_1150629887 26 Left 1150629881 17:66872120-66872142 CCTAATTACCTGGAAGCAGCCAT 0: 1
1: 0
2: 1
3: 14
4: 132
Right 1150629887 17:66872169-66872191 CAGTCTGTGAATTTTGTATACGG 0: 1
1: 0
2: 3
3: 23
4: 253
1150629882_1150629887 18 Left 1150629882 17:66872128-66872150 CCTGGAAGCAGCCATCATCAACA 0: 1
1: 1
2: 0
3: 21
4: 242
Right 1150629887 17:66872169-66872191 CAGTCTGTGAATTTTGTATACGG 0: 1
1: 0
2: 3
3: 23
4: 253
1150629885_1150629887 7 Left 1150629885 17:66872139-66872161 CCATCATCAACATTTTGGGTTAT 0: 1
1: 1
2: 3
3: 15
4: 304
Right 1150629887 17:66872169-66872191 CAGTCTGTGAATTTTGTATACGG 0: 1
1: 0
2: 3
3: 23
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150629887 Original CRISPR CAGTCTGTGAATTTTGTATA CGG Intronic
903236572 1:21954572-21954594 CAATCGGTGAAATTTGAATATGG - Intergenic
903991496 1:27273610-27273632 CAGTTAGTGAAATTTGAATATGG + Intronic
904242765 1:29159819-29159841 CATTTTGTGAATATTTTATATGG + Intronic
904741834 1:32683332-32683354 CAGCCTTTGAATATTATATAAGG + Exonic
905735508 1:40322995-40323017 CAATCTGTTAATATTTTATATGG - Intergenic
907805373 1:57813812-57813834 CAGTCTATGAATTATCTATAAGG - Intronic
908810964 1:67982027-67982049 CTGTGTTTGAATTTGGTATATGG - Intergenic
909095234 1:71278279-71278301 CAGCCTGTCCATTTTGCATAGGG + Intergenic
909168118 1:72255072-72255094 CAGTCTGTCAATTCTATTTATGG + Intronic
909197408 1:72645616-72645638 CAGTCTTTGAATTTGTTTTAAGG + Intergenic
909621919 1:77677948-77677970 TAGTCTTTGACTTGTGTATAAGG - Intronic
909763127 1:79319347-79319369 CAATCTGTGAATTTTGAATAAGG + Intergenic
909847302 1:80411153-80411175 GAGTCTATGAAATTTGTATTTGG + Intergenic
910813405 1:91261951-91261973 CAGTATGTTAATTTTGTAAAGGG - Intronic
911689541 1:100816997-100817019 AAGTCCTTGATTTTTGTATAAGG - Intergenic
912857658 1:113185433-113185455 AAGTCTTTAATTTTTGTATATGG - Intergenic
913829484 1:123217078-123217100 CAGTCTGTCAATTCTGTAAGTGG + Intergenic
913840341 1:123411101-123411123 CAGTCTGTCAATTCTGTAAGTGG + Intergenic
913867332 1:123895786-123895808 CAGTCTGTCAATTCTGTAAGTGG + Intergenic
914883186 1:151563563-151563585 CACTCTGTGATGTTTGTACAAGG + Intronic
916664535 1:166954121-166954143 CAGTCATTGAATTTTATATGAGG - Intronic
916790541 1:168121413-168121435 CTGTCGGTGAATTTTTTAAAAGG + Intronic
918084417 1:181233144-181233166 AAGTATTTGATTTTTGTATATGG - Intergenic
920070909 1:203302576-203302598 TAGTTTGTGAACTTTGTGTAGGG - Intergenic
920698839 1:208202601-208202623 CTGTCTGTGGATTTTGTACATGG - Intronic
924254292 1:242166840-242166862 TAGTCTGTGAATTTTAAAGAAGG - Intronic
1063183258 10:3626150-3626172 TATTCTGTGCTTTTTGTATAAGG + Intergenic
1063345520 10:5308689-5308711 CATCTTGTGAATTTTTTATATGG - Intergenic
1064487843 10:15814672-15814694 CAGCCAGTGAACTTTGTCTAGGG - Intronic
1065608857 10:27450166-27450188 CAATCTGTGTATTTGGTAAATGG + Intergenic
1066395797 10:35020347-35020369 CAGTCAGGGAAATTTGAATATGG + Intronic
1069249426 10:66249132-66249154 TAGTCTTAGATTTTTGTATATGG - Intronic
1070366197 10:75739389-75739411 CAGCATATGAATTTTGTACATGG - Intronic
1071125586 10:82331334-82331356 CAGTCTCAGAATTGTGTAAAAGG + Intronic
1073841281 10:107501872-107501894 AGGGCTGTGAATTTTGTGTAGGG + Intergenic
1074352277 10:112749239-112749261 CTGTCTGTGAATTTGGCATATGG + Intronic
1074893264 10:117753014-117753036 CAATCTCTGAATTTTGTTTCAGG + Intergenic
1075008794 10:118850828-118850850 CAGGCTGTGTATATAGTATATGG - Intergenic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1077421982 11:2456026-2456048 CTGTCTTTAATTTTTGTATATGG - Intronic
1077676186 11:4194801-4194823 CATTCGGTGAAATTTGAATAAGG - Intergenic
1077772737 11:5238002-5238024 AAGAATGTGAATTTTGTAGAAGG - Intergenic
1078201285 11:9186147-9186169 CAGTCTTTGAATTTTTGACATGG - Intronic
1079071043 11:17347624-17347646 CAGTTGGTGAAATTTGAATACGG - Intronic
1079578022 11:22027127-22027149 CAGTCTGTGTCTTTTGGTTAGGG - Intergenic
1079785889 11:24672678-24672700 CAGTCTATGATTTTTGCACAAGG - Intronic
1080913935 11:36635771-36635793 CAGTCTGAGAGTTTTTTAAAAGG - Intronic
1081026201 11:38018658-38018680 CAGTTTTTGGATCTTGTATAAGG - Intergenic
1081939824 11:46931242-46931264 CAGTCTGGGTATTTTATACATGG + Intergenic
1083105565 11:60355135-60355157 CAGTCTGTGAATTCTGACTGGGG - Intronic
1090103891 11:123830939-123830961 CACACTGTGACTTTTGTATATGG - Intergenic
1090111603 11:123916380-123916402 CTGTATTTGATTTTTGTATAAGG - Intergenic
1090525264 11:127527533-127527555 CAGTCTGTGTACATTATATATGG - Intergenic
1092505858 12:9099191-9099213 AAGTTTGAGAGTTTTGTATAAGG + Intronic
1094428494 12:30341036-30341058 CACCCTGTGATTTTTGTATCTGG + Intergenic
1095030592 12:37270790-37270812 CAGTCTGTGAAATTTGCAAATGG - Intergenic
1095774674 12:45999451-45999473 CAGTCTGTGATTTTTTTTTATGG + Intergenic
1097971101 12:65633950-65633972 AAATCAGTGAATTTTGAATAAGG - Intergenic
1100520750 12:95373476-95373498 CTATCTGTGAATTATGTGTATGG - Intergenic
1102581581 12:113891646-113891668 AAGTCAGTGAATTTTTTTTAAGG - Intronic
1102655976 12:114482545-114482567 GTGTCTGTGTATTTTGGATACGG + Intergenic
1105697798 13:22907339-22907361 CAGTCTGTTACTAATGTATAAGG + Intergenic
1106753607 13:32798907-32798929 CACTCTGTTAATTTTGCAAAGGG + Intergenic
1107100382 13:36584005-36584027 CAGTCTGTAAATTTTTCATTTGG + Intergenic
1107246703 13:38305406-38305428 GAGTTTGTGAATTTTGTTTAAGG - Intergenic
1109204011 13:59461773-59461795 AAGTCTGAGAATTGTGTATGGGG - Intergenic
1109282698 13:60375396-60375418 CAGTTTCAGATTTTTGTATAAGG - Intergenic
1109793204 13:67276659-67276681 CTGTTTGTGAATTTTGTAGGTGG - Intergenic
1112722380 13:102259437-102259459 CAGTCAGGGAAGTTTTTATAAGG - Intronic
1112988754 13:105485262-105485284 CTGTCTGTGAAATTTTTATGTGG - Intronic
1113117984 13:106894062-106894084 TAGTCTATAAAATTTGTATACGG + Intergenic
1114352369 14:21866988-21867010 CAGGCTGGGAATTTTGTCCAGGG + Intergenic
1115329454 14:32179681-32179703 CTGGGTGTGATTTTTGTATATGG + Intergenic
1116145883 14:41068752-41068774 ATGTCTGTGACTTTTGAATATGG + Intergenic
1116374539 14:44182168-44182190 AAGTCTGTGAAGTTTTTAAAAGG - Intergenic
1116859563 14:49982970-49982992 CAGTTTGTAAATTTTGTTTGTGG - Intronic
1117901699 14:60540540-60540562 CCATCTTTGATTTTTGTATATGG + Intergenic
1117985325 14:61381066-61381088 CAGTTTCTGAACTTTGTACAGGG - Intronic
1118665208 14:68061507-68061529 TAGTCTGTCAATTATGAATATGG + Intronic
1119459115 14:74783445-74783467 TAATGTTTGAATTTTGTATAAGG - Intronic
1119573939 14:75701459-75701481 CTGACTGTGAATTTTGTGTAAGG + Intronic
1120960246 14:90117926-90117948 CAGTATGTGACTTTTGTGTCTGG + Intronic
1125915004 15:43478549-43478571 CAGTAAGTGAAGTTTGAATATGG - Intronic
1126998282 15:54471567-54471589 CAGTCTATGACTTTTCCATAAGG + Intronic
1127403076 15:58611839-58611861 CAGTCTGTGAAGTTTGGTTTAGG + Exonic
1127962616 15:63900962-63900984 CAGTCTGTGATATTTGGTTATGG + Intergenic
1128533986 15:68476511-68476533 AAGTCTGCAATTTTTGTATAAGG - Intergenic
1130369251 15:83269966-83269988 CAGTCTGTGACTTTTGTGCCTGG - Intronic
1131343396 15:91624101-91624123 TAGTCTGTAAATCCTGTATATGG + Intergenic
1131610440 15:93955579-93955601 CACTCTGTGTACATTGTATAGGG + Intergenic
1131760252 15:95615038-95615060 CAGTCTTTGCTTTTTGTTTAAGG + Intergenic
1132034186 15:98466891-98466913 CAATCTGTGAATTCTGTCTTAGG - Intronic
1132215957 15:100061822-100061844 CAGACTGCGAATTTTGAATTAGG + Intronic
1132923390 16:2412414-2412436 AAGTCTGTGAGTATTGTAAATGG + Intergenic
1132985243 16:2762883-2762905 GTGTCTGTGACTTTTGTTTAGGG - Exonic
1138746213 16:59365955-59365977 CAGTCTCTGAAATTTGCTTAAGG - Intergenic
1139304389 16:65971091-65971113 CACTCTGTGGATTTTTTCTATGG + Intergenic
1139767040 16:69239212-69239234 CAGTTTGTAAATTTTAAATATGG - Intronic
1140314000 16:73876061-73876083 CAGTGTCTGAATTTTTTAAAAGG + Intergenic
1140538339 16:75731740-75731762 AAGTCAGTGAAGTTTGTAAATGG - Intronic
1144195501 17:12890726-12890748 CAGGCTGTGAATTTTCCAGATGG + Intronic
1144579250 17:16448890-16448912 CAGTCTGTGATTTTTTGTTATGG + Intronic
1144781997 17:17813010-17813032 CAGTCTGTGGACTTTGTGTGTGG - Intronic
1144817330 17:18044508-18044530 CACTCTGTGCATTTTATATATGG - Intronic
1148705042 17:49622695-49622717 CAGCCTGTGAATCTTGCATCTGG - Intronic
1149335356 17:55629988-55630010 GAGTCTGTGTATTTTGCATGTGG + Intergenic
1149826071 17:59829421-59829443 CAATCTGTCATTTTTGAATAAGG + Intronic
1150629887 17:66872169-66872191 CAGTCTGTGAATTTTGTATACGG + Intronic
1151452984 17:74210766-74210788 CAGTCTTTGAATATTCTGTAAGG + Intergenic
1153325652 18:3817319-3817341 CAGTCTGTAACTGTTGTTTAGGG + Intronic
1155933031 18:31726294-31726316 CAGTCTGTGCACTTAGTAGAAGG - Intergenic
1156532655 18:37832964-37832986 TTGTCTTTGAATTTTGTGTATGG - Intergenic
1156730348 18:40186717-40186739 CAGTTTGTGAAATTGGAATATGG - Intergenic
1157348624 18:46864081-46864103 CAGTCTGTGAAATTTTGTTATGG + Intronic
1158889040 18:61856151-61856173 CAGCCAGTGAATTTTGTTAATGG - Intronic
1160484739 18:79279283-79279305 CTGTCTGTGAACTCTGCATAAGG - Intronic
1164091565 19:21957501-21957523 CAGTCCAGGAATTTTGTATGAGG - Intronic
1165875784 19:39005715-39005737 AAGTCTGTGAATTTTGTTACGGG + Intronic
925688644 2:6497298-6497320 CACTCTGTGATGTTTGTACAAGG + Intergenic
925996960 2:9301346-9301368 AAGTCTGTGAATTTTCTCTGCGG + Intronic
926492864 2:13545995-13546017 CATTCTGTGAATACAGTATAAGG - Intergenic
926693882 2:15757087-15757109 CAATCTGTGACCTTTGTATCTGG - Intergenic
928223430 2:29424896-29424918 AGGTCTGTGAATTTTATTTATGG - Intronic
928246978 2:29638854-29638876 CATTCTCTGCATTTTGTATATGG - Intronic
929475773 2:42246575-42246597 CAGTTTCTGAATGTTGTTTAGGG + Intronic
932502696 2:72197931-72197953 CAGTCTGAAACTTTTGTATAGGG + Intronic
932741383 2:74293465-74293487 AAGCCTGTGAATTTTGAATTGGG + Intronic
933212657 2:79588839-79588861 TATTCTGTGAACTTTCTATACGG - Intronic
933306081 2:80600191-80600213 CAGTTTATGCCTTTTGTATAGGG - Intronic
934484833 2:94696067-94696089 TGGTCTCTGAATTTTGTAAAAGG - Intergenic
935382253 2:102464791-102464813 CAGTCTGTGACTTTTGTATGAGG + Intergenic
935846434 2:107170529-107170551 CAGTCTGTGATATTTGGCTACGG + Intergenic
937329959 2:121020244-121020266 CAATCTGTGAAATTTGAATATGG + Intergenic
941282013 2:163563932-163563954 CACGCTGTGATGTTTGTATAAGG - Intergenic
941933018 2:170961336-170961358 CTGTCTTAGAAATTTGTATATGG - Intronic
943780811 2:191821633-191821655 AATTCTGTGAATTTTGTGTCCGG - Intergenic
943822278 2:192340730-192340752 CACTCTGAGAATTCTGTAAATGG + Intergenic
944624475 2:201557244-201557266 CAGTAACTGAAATTTGTATAAGG - Intronic
946209941 2:218139440-218139462 CTGTCTCTGAATTTTGTTTTGGG - Intergenic
947231109 2:227887289-227887311 CAACCTGTGATTTTTGTAAATGG + Intronic
947701187 2:232235586-232235608 CAGTTTGTCAATTTTGACTAAGG + Intronic
948111846 2:235462627-235462649 CAGTCTATGGCATTTGTATAAGG + Intergenic
1168881291 20:1208426-1208448 CAACCTGTGATTTTTGTATTTGG + Intergenic
1169788024 20:9381386-9381408 CATTCTTTGAAGTTTGTAGAGGG + Intronic
1170285029 20:14697500-14697522 CAATCAGTTAATTTGGTATATGG - Intronic
1171150512 20:22822998-22823020 CAGTCAGTGAAATCTGAATAAGG - Intergenic
1174312251 20:49666658-49666680 TTATCTGTGTATTTTGTATATGG - Intronic
1176872677 21:14096424-14096446 GAGTCAGTCAAATTTGTATAAGG - Intergenic
1177050850 21:16230723-16230745 CAGTCTCTCTATTTTGTTTAAGG + Intergenic
1177397420 21:20555450-20555472 CAATCTGTGCATTTTGAAGAAGG + Intergenic
1181936250 22:26440949-26440971 CAGTCTGTGACTTTCATAAAAGG + Intronic
949335096 3:2966020-2966042 CAGACTGTGAATTTCCTAAAGGG + Intronic
950799743 3:15540503-15540525 AAGACTTTGAATGTTGTATATGG - Intergenic
952440833 3:33326729-33326751 GAGTCTTTGAAGTTTGGATATGG - Intronic
952586381 3:34897827-34897849 AAATCTGAGAATTTTGTATGTGG - Intergenic
952640680 3:35591374-35591396 CATTATTTGAATTTTGTTTAAGG + Intergenic
953057641 3:39400911-39400933 CAGTCTGGGAAATGTGAATATGG - Intergenic
954758672 3:52858150-52858172 CAGTCTGTGATATTTGGTTATGG + Intronic
958666310 3:97142404-97142426 CAGTCTATCAATTTTGCTTATGG - Intronic
958899923 3:99873694-99873716 AAGGCTGTAAATTTTGTTTAAGG - Intronic
958930172 3:100199251-100199273 CAGTGAGTCAATTTTGTTTACGG - Intergenic
959852019 3:111098542-111098564 CACTCTGTGTATTTTCTGTAAGG + Intronic
964579211 3:158212578-158212600 TATTCTGTTGATTTTGTATATGG + Intronic
964839933 3:160982526-160982548 CATTCTGTTAATTTTTTAAATGG + Intronic
965360148 3:167729033-167729055 CATTCTGGGACTTTTGCATAGGG - Intronic
968246691 3:197157032-197157054 CACTGTGTGTGTTTTGTATATGG - Intronic
968628860 4:1640069-1640091 CACTCTGTGAATTTAATACAAGG - Exonic
969423234 4:7109173-7109195 CAGTGGCTGAATTTTGTATCTGG + Intergenic
971933180 4:33112619-33112641 CCCTGTGTGAATTTTTTATATGG - Intergenic
973661152 4:53107407-53107429 CAGTCTGTGTATTTTATTTGGGG - Intronic
974773707 4:66451039-66451061 CAGTCTGTGATATTTATTTATGG + Intergenic
975441201 4:74412883-74412905 TTGTCTGTGAATTTTGCATTTGG + Intergenic
976394266 4:84539051-84539073 CAGTGTGTGATGTTTGCATAAGG - Intergenic
977532539 4:98217249-98217271 CAGTCTGTATAGTTTGTATGAGG + Intergenic
977984630 4:103367803-103367825 AAGTCTGTGACTTTCATATAAGG - Intergenic
978076995 4:104543139-104543161 CAGTCTGTGTCTTTTTAATAGGG - Intergenic
978364185 4:107963379-107963401 CATTCTGTTAATGTAGTATATGG - Intergenic
979508156 4:121521560-121521582 CAGTTGTTGAATTTTGTAAAAGG - Intergenic
983545082 4:168954595-168954617 CACTCAGTCAATTTAGTATATGG + Intronic
984397181 4:179216934-179216956 CAGTCTGTGGAATTTTTCTAAGG + Intergenic
984920960 4:184763970-184763992 CAGTCTGTGAATCTTCTTTATGG - Intronic
987267761 5:16276023-16276045 CAGTGTGTGAAATGTGTGTAAGG - Intergenic
987873142 5:23646463-23646485 CAGTCTGTGTCTTTTATATGGGG - Intergenic
988233033 5:28504936-28504958 CATTTTGTGATTTTTGTACATGG - Intergenic
988348223 5:30068649-30068671 CAGTCTGTGAAATTTTGTTATGG - Intergenic
989760384 5:45008430-45008452 TAAACTGTGAATTTTGAATAGGG - Intergenic
990530731 5:56670824-56670846 CAGTCTGTGAGTTTTGATGAAGG - Intergenic
991002231 5:61794071-61794093 AAGTCTTTAATTTTTGTATAAGG + Intergenic
991230728 5:64330432-64330454 AAGTCTGGTAATTTTGTCTAAGG + Intronic
992451015 5:76875844-76875866 CTGTCTGTAAATTATGTATTGGG + Intronic
993969992 5:94407583-94407605 CAGTATGTGCATTTTGTGTCCGG - Intronic
994445514 5:99868354-99868376 CATTTTGTTGATTTTGTATATGG + Intergenic
996022269 5:118604422-118604444 CAGGATATGAATTTTGTGTAAGG - Intergenic
996351863 5:122552561-122552583 CAGTCTGTGAGGTTACTATAAGG + Intergenic
997843302 5:137262349-137262371 CAGTCTGTGCCTTTGGTATGTGG - Intronic
999740288 5:154544771-154544793 CAGTCTGTGATATTTTAATAAGG + Intergenic
1000975016 5:167755147-167755169 CAGTCTGTGAGTTTTCTCCATGG + Intronic
1001010013 5:168088886-168088908 CATTCTGTGAAGTTCGTAAAAGG + Intronic
1001674092 5:173498217-173498239 CCTTCTGTGAATATTGGATATGG + Intergenic
1004120022 6:12812248-12812270 CAGTATGTGACTTTTGTGTCTGG + Intronic
1004410877 6:15380337-15380359 CAGTAAGTGAATTTTTTATTGGG + Intronic
1005123785 6:22421748-22421770 CAGTTTGGGTATTTTGCATATGG + Intergenic
1007577084 6:42932106-42932128 GAGTCTGTGAATGTTGCCTAAGG - Intronic
1008240938 6:49111089-49111111 CAGTCTGTTAATTTGCTGTAAGG - Intergenic
1008261949 6:49377519-49377541 TAGTCTGTTAATTTTCTACAAGG + Intergenic
1008707702 6:54182647-54182669 CATTCTATGAACTTTGTAGAGGG + Intronic
1010042084 6:71396805-71396827 CAGTGTGTGTATTTGGGATACGG - Intergenic
1010830121 6:80517029-80517051 CATTCTCTAAATTTTGTATGTGG - Intergenic
1011735416 6:90305550-90305572 CAGTTGGTGAAATTTGAATAGGG - Intergenic
1012339140 6:98097336-98097358 CAGGCTGTGAATATGGCATATGG - Intergenic
1013885740 6:114964061-114964083 CAATATGTGAATTTTGTGTCTGG + Intergenic
1014535963 6:122613440-122613462 TAATATGTGATTTTTGTATATGG - Intronic
1014915778 6:127146180-127146202 TAATCAGTGAATTTTGAATATGG - Intronic
1015821645 6:137267364-137267386 CAGTCAATGAACTTTGAATATGG - Intergenic
1016761461 6:147742011-147742033 CAGTCTTTGCATGTTGAATATGG - Intergenic
1016931154 6:149411330-149411352 CAGGCTTTGCATTTTGTATATGG + Exonic
1017573488 6:155774376-155774398 CAGTCTGTGTTTTCTGCATATGG + Intergenic
1017615349 6:156241328-156241350 CAGTCTGTGAAATTTTGTTATGG + Intergenic
1018636766 6:165868243-165868265 CAGTCTATCAATTTTGTTTATGG - Intronic
1020512189 7:9071055-9071077 CAGTCTGGGAATTTTTTAAAAGG + Intergenic
1020606720 7:10347253-10347275 AGGTCTGTGAATTTTTTTTAAGG + Intergenic
1022881311 7:34590743-34590765 CTGTCTATTAATTTTGTCTATGG + Intergenic
1023276718 7:38526922-38526944 CTTTCAGTTAATTTTGTATAAGG + Intronic
1024341295 7:48264340-48264362 CAGTTTGTGAATTTTGTAAAAGG - Intronic
1024443477 7:49449301-49449323 CAGTCTGTGATTTTTTTTTAAGG - Intergenic
1027277025 7:76567578-76567600 CAGTCTGGGAATTTTTTTTATGG - Intergenic
1027688490 7:81309462-81309484 TAGAGGGTGAATTTTGTATAGGG - Intergenic
1028473124 7:91225774-91225796 CAGTGAGTGTATTTTGCATATGG - Intergenic
1028861271 7:95653408-95653430 CTGTCAGTTAATTTTTTATATGG + Intergenic
1030054685 7:105573310-105573332 CAGTTTCTGAATTTGATATATGG - Intronic
1030423282 7:109337376-109337398 CAGTCTGTGTATTTTGTTATTGG - Intergenic
1032751302 7:134844638-134844660 CAGTCTGTGGATTTTCACTATGG - Intronic
1033542476 7:142369624-142369646 CAGTCTGTGCATTTGGGTTAGGG - Intergenic
1035626312 8:1073664-1073686 CTGTGTGTGCATTTTGTAGATGG + Intergenic
1035951384 8:4025280-4025302 CACTGTGTGGATTTTGGATAGGG - Intronic
1038303064 8:26373349-26373371 CAGTGTGTGACTTTTGAGTAAGG + Intergenic
1039154291 8:34537582-34537604 CAGTCTGTGTCTTTTAAATAGGG - Intergenic
1039558090 8:38491268-38491290 CAGTCTGTGCATTCAGTACAGGG - Intergenic
1040898988 8:52397612-52397634 CATTTTGAGATTTTTGTATATGG + Intronic
1041149659 8:54918062-54918084 CACTCTGTGATGTTTGCATATGG - Intergenic
1041780488 8:61573695-61573717 AAGTCTTTAATTTTTGTATAAGG - Intronic
1041861304 8:62515995-62516017 CTGTCTGTCAACTTTGTCTAAGG + Intronic
1043172575 8:76983748-76983770 CAGTGTGTGAATTTTGTGATTGG - Exonic
1043534446 8:81186919-81186941 CAGACTCTGAAATTTGAATAGGG - Intergenic
1043588759 8:81801685-81801707 AAGTATGTAAATTTTCTATAAGG - Intronic
1047117136 8:121855976-121855998 CAGTCTCAGACTTTTGCATATGG - Intergenic
1047230801 8:122996320-122996342 CAGTCTGTGCATTTTACAGATGG + Intergenic
1047987671 8:130252380-130252402 CAATCTTTTAATATTGTATAAGG - Intronic
1048314359 8:133351132-133351154 CAGTCTGTGGTATTTGTTTATGG - Intergenic
1048957755 8:139550815-139550837 CAGTCTGTTAATTCTGAGTATGG - Intergenic
1050188107 9:2996476-2996498 TAGGCTGTGAATCTTGAATAAGG - Intergenic
1050473487 9:6017329-6017351 CAATCTCTCAATTCTGTATAAGG - Intergenic
1050792042 9:9484981-9485003 CAGTTTATGAATTATGCATATGG + Intronic
1050978097 9:11967737-11967759 CTTTCTGTGAATTTGGAATAAGG - Intergenic
1052202045 9:25794515-25794537 CACTCTGTGAATGTTGTAGGTGG - Intergenic
1052399533 9:27983305-27983327 CAGTCTGTGTATTTATGATACGG - Intronic
1053439131 9:38100950-38100972 CTGCAAGTGAATTTTGTATATGG - Intergenic
1055822825 9:80288348-80288370 CTGCCTGTGAATTGTGTCTAAGG + Intergenic
1057735438 9:97654861-97654883 CAAGCTGTGAATTTAGGATAAGG - Exonic
1059864466 9:118499441-118499463 CAGTCTGTGTATTTTAATTAGGG + Intergenic
1060843594 9:126816413-126816435 CAGTCTCTGAATAAAGTATAAGG - Intronic
1186042845 X:5500610-5500632 CAATCTGTGAAATTTCTATTGGG - Intergenic
1188023147 X:25180630-25180652 CAGTCTGTAAATTGTGAAGAAGG - Intergenic
1189742797 X:44138157-44138179 CAGTATGTGACCTTTGTATCTGG - Intergenic
1191222569 X:58004929-58004951 CAGTCTGTGTATTTTAATTAGGG - Intergenic
1191589550 X:62867240-62867262 CAGTCTGTTATTGGTGTATAAGG + Intergenic
1192000778 X:67149018-67149040 CAGTCTGTGTATTTTAATTAGGG + Intergenic
1192688252 X:73330496-73330518 CAGTCTGTGTCTTTTAAATAGGG + Intergenic
1193332555 X:80251441-80251463 CAATCTGTGCATTTTATATGAGG + Intergenic
1193516276 X:82468805-82468827 CATTTTGAGATTTTTGTATATGG + Intergenic
1194584526 X:95716530-95716552 CAGTAAGTTAATTTTGTCTATGG - Intergenic
1194694552 X:97029733-97029755 CAGTCAATGAATTTTGGATAAGG - Intronic
1195674150 X:107494523-107494545 AAGCCTGTGGATTTTGTATAAGG - Intergenic
1196775797 X:119335793-119335815 CAGGCTGTTAATTATGTTTAGGG - Intergenic
1196913254 X:120505612-120505634 CTGTCTTAGAATTTTGTATCAGG + Intergenic
1197266058 X:124373187-124373209 CAGTCTCTGAATATTTTATAAGG - Intronic
1198002036 X:132449612-132449634 CAGTCTGTGTCTTTTGTTTAGGG + Intronic
1198236600 X:134741464-134741486 CTGTCTGGAAATTTTGGATAAGG + Intronic
1198565455 X:137900200-137900222 TTGTCTGTTAATTTTGTTTATGG + Intergenic
1199025952 X:142938178-142938200 CAGTCTCAGAATTTTCTAAAAGG - Intergenic