ID: 1150630087

View in Genome Browser
Species Human (GRCh38)
Location 17:66874199-66874221
Sequence CAGGATTAAAATGGGGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150630081_1150630087 7 Left 1150630081 17:66874169-66874191 CCTGTAAAATGGGTGTGGTAATA 0: 1
1: 0
2: 15
3: 111
4: 479
Right 1150630087 17:66874199-66874221 CAGGATTAAAATGGGGAGTAAGG 0: 1
1: 0
2: 2
3: 23
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150630087 Original CRISPR CAGGATTAAAATGGGGAGTA AGG Intronic
900878130 1:5360598-5360620 CAGGATTATCATGGGGAGGGAGG + Intergenic
902795704 1:18799356-18799378 AAGGATTAAGACAGGGAGTAGGG + Intergenic
904291297 1:29487751-29487773 CAGGAATAAAATGGGCAGGCTGG + Intergenic
905260639 1:36715837-36715859 CAGGGATAAAATGGTGAGTAAGG - Intergenic
910008667 1:82432984-82433006 CAGGATTACATTGGGGATGATGG - Intergenic
910653245 1:89592575-89592597 CAGGAGTACAATGAGGAGTGAGG - Intronic
910970410 1:92850271-92850293 CAGGAATACAATGGTGATTAAGG - Intronic
917071164 1:171152388-171152410 AAGGCTTAAAATGGGGTGTGGGG + Intronic
918263774 1:182820939-182820961 CAGAATTAAAATGCCTAGTATGG - Intronic
918385907 1:184007087-184007109 CAGCATTAAAATGTGCAGTATGG + Intronic
919645296 1:200088875-200088897 AAGGATTAAAATGGGGAGAGAGG - Intronic
921328487 1:214011867-214011889 CATGATTCCAATGGGGACTATGG - Intronic
1063634863 10:7772352-7772374 CAGAATGAAAATGGAAAGTAAGG + Intronic
1064371489 10:14755571-14755593 CAGGATTAAATTGAGGATGATGG - Intronic
1064963894 10:20995951-20995973 TAAGATTAAAATTGGAAGTATGG - Intronic
1066195008 10:33090553-33090575 TAAGATTGAAATGGAGAGTAGGG + Intergenic
1067997284 10:51287691-51287713 CAAGATTTAAATGGGGAGAAGGG + Intronic
1068819166 10:61353125-61353147 CTGGATAAAAGTGGGGAGGAAGG - Intergenic
1070595194 10:77827956-77827978 CAGGATTAAAGGGGGAAGAAAGG + Intronic
1071281912 10:84111084-84111106 CAGGATTACAATTGGGGGCAAGG + Intergenic
1071982491 10:91017780-91017802 TAGGATTAAAATGATGGGTAAGG + Intergenic
1072512357 10:96140197-96140219 ATGGATTAATGTGGGGAGTAAGG + Intronic
1073177451 10:101565118-101565140 CAGGAGTGAAAAGGGGAGTTAGG + Intergenic
1074566870 10:114587721-114587743 CAGGACTAAAGAGGGGAGCATGG - Intronic
1078634870 11:13039863-13039885 CAGGCATAAAATATGGAGTATGG + Intergenic
1078895462 11:15593344-15593366 CATGATTTAAATGTGTAGTATGG - Intergenic
1079630774 11:22671842-22671864 CATGATCAAAATTTGGAGTATGG - Intronic
1080606347 11:33868503-33868525 CAGCGTTAACATGGGGAGTAAGG - Intronic
1080642967 11:34168568-34168590 CAGCTGTAAAATGGGGAGGATGG - Intronic
1080947141 11:36986161-36986183 CTTGATTAAAATGAGAAGTAAGG - Intergenic
1082232587 11:49786307-49786329 CAGTTTTAAAATTTGGAGTAAGG - Intergenic
1082309310 11:50627277-50627299 CAGGATAAAAACTAGGAGTAAGG + Intergenic
1084545775 11:69814390-69814412 GATGATTAAGATGGGGAGTCGGG + Intronic
1085826027 11:79847735-79847757 CAGGAATAAAATAGGGAGAGAGG + Intergenic
1086618048 11:88847634-88847656 CAGTTTTAAAATTTGGAGTAAGG + Intronic
1086770494 11:90758580-90758602 AAGGATAAAAATTGGGAGTAAGG + Intergenic
1087767758 11:102174959-102174981 CTGGATTACAATGGGCAGTGTGG - Intronic
1089266491 11:117266705-117266727 CAGGAGGAAAAAGGGGAATAGGG - Intronic
1091169405 11:133507024-133507046 CAGGATGAAAATGGGAAGTGGGG - Intronic
1091904666 12:4174826-4174848 CATCATTAATATGGGGAGCAGGG - Intergenic
1092006061 12:5071385-5071407 CTGGTTTAACATGGGGAGTGAGG + Intergenic
1092993460 12:13925693-13925715 CAGGAATGAAAGGTGGAGTAAGG - Intronic
1093381756 12:18501308-18501330 CAGGAAAAAAAGGGGGAGAATGG + Intronic
1093668160 12:21839195-21839217 CAAGTTTAAAATAGGAAGTAGGG + Intronic
1093989343 12:25572569-25572591 CAGGGTTACACTGGGGAGGAGGG + Intronic
1094222756 12:28012274-28012296 CAAGATAAAAATGTGGAGTGTGG + Intergenic
1094339696 12:29397218-29397240 AAGGATTTAATTGGGGAGTGAGG - Intergenic
1094426706 12:30323634-30323656 CAGGAGAAAAATGGGGACCATGG + Intergenic
1094582013 12:31742034-31742056 AAGAATTAAAAGGGGTAGTAAGG + Intergenic
1095996618 12:48092153-48092175 CAGGATGAAAATGAGCAGCAAGG - Intronic
1098103281 12:67041954-67041976 CACTGTTAAAATGGGGATTAAGG - Intergenic
1098185521 12:67892311-67892333 CAGGATCAAAATTGGGAGCAGGG + Intergenic
1098748313 12:74266949-74266971 CAGGATTACAATTGGGGGCAAGG + Intergenic
1099729411 12:86479802-86479824 CAAAAATAAAATTGGGAGTAAGG + Intronic
1100011482 12:89959416-89959438 AAGTAATAAAATGGGGGGTAGGG + Intergenic
1100352562 12:93798500-93798522 CATGATTAAAATGGAGAGGAGGG - Intronic
1103197851 12:119060886-119060908 CAGGATTTAATTGGCAAGTAGGG - Intronic
1104266374 12:127236968-127236990 CAGGATTAAACTGGACAGAACGG + Intergenic
1105572695 13:21618990-21619012 CAGGTTTAGACTGGGCAGTAAGG + Intergenic
1107140594 13:36994736-36994758 CAGGATTAAAATGGGTAGGAGGG + Intronic
1107509632 13:41070249-41070271 CAGGAATACAATGGTGAGTAAGG - Intronic
1108837293 13:54567493-54567515 CAGGGTGAGAATGGAGAGTATGG + Intergenic
1109802691 13:67399826-67399848 CAGGATTACAATTGGGGGCAAGG + Intergenic
1109815117 13:67571690-67571712 TAGGATTAAAAATGGGAGGAGGG + Intergenic
1112156040 13:96817891-96817913 CATGATTAAAATGGTGTGTTGGG - Intronic
1112393369 13:99005455-99005477 AAAGAAAAAAATGGGGAGTAGGG + Intronic
1112433174 13:99370799-99370821 CAGGATTAACAGGTGGAGTATGG + Intronic
1112628410 13:101133750-101133772 CAAGATTAAAATGTTGATTATGG + Intronic
1116692035 14:48120724-48120746 TTTGATTAAAATGGGGAGTTGGG - Intergenic
1117608224 14:57454212-57454234 AAAGATTAAAAATGGGAGTAAGG + Intergenic
1117810201 14:59537350-59537372 CAGGATGAAAATAGGGAGCTTGG - Intronic
1119348240 14:73943715-73943737 AAGGATTAAAAGGGGAAGCATGG - Intronic
1119796711 14:77404722-77404744 CAGGAAGAAAATGAGGAGAACGG + Intronic
1120778422 14:88463177-88463199 CTGGCTTGAAATGGGAAGTAAGG - Intronic
1125476856 15:40053614-40053636 CAGGATCAAACTGGGGAGATAGG - Intergenic
1126951510 15:53886667-53886689 CAGCATTAAAAAGGGAGGTAGGG + Intergenic
1127034683 15:54902249-54902271 CAGGATAATAATGGGCAGAATGG - Intergenic
1127654773 15:61045765-61045787 AAGGAATGGAATGGGGAGTAGGG - Intronic
1128264394 15:66254164-66254186 CAGGAGGGAAAGGGGGAGTAGGG - Intergenic
1129016440 15:72473606-72473628 CAGGTATAAAATGGGTACTATGG + Intergenic
1129086010 15:73093126-73093148 CAGGATTAGACTGGGGCTTATGG + Intronic
1130788916 15:87131102-87131124 GAGAATAAAAATGGGTAGTAGGG + Intergenic
1131967796 15:97863347-97863369 CAGGATTAATATGCAGAATATGG - Intergenic
1135939525 16:26809449-26809471 AAGGATGAAAAGGGGGAGGAAGG + Intergenic
1137690527 16:50423801-50423823 CAGAATTCAATTGGGGATTATGG - Intergenic
1138677993 16:58665729-58665751 CGGGAATATAGTGGGGAGTAGGG + Exonic
1139164322 16:64548073-64548095 CAGGATTGAGAAGGGGTGTAGGG - Intergenic
1139324528 16:66141756-66141778 CATGTATAAAATGGGGAGTTTGG + Intergenic
1140467388 16:75193546-75193568 CAGGATAAAAATGGGCTGTATGG - Intergenic
1140882909 16:79215053-79215075 CATCAGTAAAATGGGGAGAAGGG - Intergenic
1141259553 16:82440280-82440302 CTGAATTAAAATGAGAAGTATGG - Intergenic
1142436202 16:90059406-90059428 CAGGATGAAGGTGGGGAGCATGG - Intronic
1143528024 17:7483576-7483598 CAGGAATAAAATGGGGGGCGGGG - Intronic
1143551405 17:7632609-7632631 CAGGATTTAAGTGGTGAGAATGG + Intronic
1147389927 17:40102907-40102929 CAGGAGTAAACTGGGTAGTGAGG + Intergenic
1148011995 17:44490000-44490022 CGAGAATAAAATGGGGGGTAAGG + Intronic
1149288098 17:55188413-55188435 CAGAATTACAATGGGGACTCTGG - Intergenic
1150630087 17:66874199-66874221 CAGGATTAAAATGGGGAGTAAGG + Intronic
1151283196 17:73091883-73091905 CAGGTTTAAAAGGGGGAGAAAGG - Intronic
1160918039 19:1507001-1507023 CAGGATCAAAGTGGGGAGGCTGG - Intronic
1162284514 19:9728245-9728267 CAGGATTACAATTGGGGGCAAGG - Intergenic
1162490201 19:10987038-10987060 CAAGCTTGAGATGGGGAGTAAGG - Intronic
1165320915 19:35084662-35084684 CAGTATTAAACTGGGGGGTTAGG + Intergenic
1168681173 19:58316978-58317000 TAGGAATAAGATGGGGAGGAAGG + Intergenic
926394360 2:12426108-12426130 CAGGAGTAAGATGGGGAGAGAGG - Intergenic
926615536 2:14993197-14993219 CATGTGTAAAATGGGGAGCATGG - Intergenic
927324834 2:21792153-21792175 AAGGATTTAAATGTGGAATAAGG - Intergenic
927638120 2:24830733-24830755 CAGGATGAAGATGGCGAGCATGG + Exonic
929532384 2:42761276-42761298 CAGGGTCAAGATGGGGAGCAAGG + Intergenic
929754152 2:44749929-44749951 CAGCATTAGAAATGGGAGTAGGG + Intronic
931254417 2:60557278-60557300 CAAGATAAAAAGGGGGAGGAGGG - Intergenic
931533032 2:63238675-63238697 AAGGATTAAAAAAGGGAGTAAGG - Intronic
932796205 2:74698286-74698308 AAGGTTTTAAATGGGGAGAAAGG + Intergenic
935053067 2:99540438-99540460 CAAGATTAGCATGGGGAATATGG - Intergenic
937043265 2:118836952-118836974 CAGTATTGAAATTGGGAGTGTGG + Intergenic
939730082 2:145773036-145773058 CAAATTTAAAATGGGGAGTTTGG - Intergenic
939997483 2:148933231-148933253 CAGTAATAAAATGGGTAATATGG - Intronic
940345060 2:152620361-152620383 CAGAAATAAAATGGGAGGTAGGG + Intronic
940397152 2:153202534-153202556 CAGGTTTCAAATGTGAAGTAAGG - Intergenic
940399113 2:153226557-153226579 CAAGATTAAAATGGGGCTTGGGG - Intergenic
940752616 2:157643832-157643854 AAGGACAAAAATGGGGAGTCAGG - Intergenic
941033660 2:160541918-160541940 CAGCATTAGAATGTGGAGGAGGG - Intergenic
941336607 2:164252938-164252960 CAGGATTAAACAGGGCAGTCTGG - Intergenic
944656129 2:201878308-201878330 CAGGACAAAAATGGGGAGAGAGG - Intronic
945512782 2:210723463-210723485 CATGATTAAAATGGGAAAAAAGG - Intergenic
945944834 2:215984957-215984979 CAGGATTGAAATGGAGAGAAAGG - Intronic
947338695 2:229114409-229114431 AAGGTTTAGGATGGGGAGTAGGG - Intronic
1172175999 20:32972265-32972287 CAGCATTAAAATGAGGAAGAGGG + Intergenic
1172986586 20:38996396-38996418 GAAGATTAAAATGGGGAGGTTGG + Intronic
1175632427 20:60552844-60552866 CAGGCTTAGCATGGAGAGTATGG + Intergenic
1178254748 21:31041834-31041856 CGGTGTTAAAACGGGGAGTAGGG - Intergenic
1179415565 21:41195591-41195613 CAGGATTGAAACAGGGAGAATGG - Intronic
1179523785 21:41962348-41962370 CAGGATTAAAAGGTGAAGTCAGG + Intergenic
1179714907 21:43281619-43281641 CAGGATGAACATCGGGAGGAGGG - Intergenic
1179724744 21:43335808-43335830 CAGGATTGAAATGGGGAGCACGG + Intergenic
1181594062 22:23902968-23902990 CAGGATTGGAATGGGAAGAAAGG + Intergenic
1184134787 22:42541319-42541341 GAGGAGTAAAAGGGAGAGTATGG - Intergenic
1184793705 22:46718547-46718569 CAGGATTAAACAGGGAAGTATGG + Intronic
949346191 3:3079065-3079087 CGAAATTAAAATGGGGAGAAGGG - Intronic
949346558 3:3082460-3082482 CAGGAATCAAATGGGGAGTCTGG - Intronic
950791498 3:15475651-15475673 CAAGAATGAAATGTGGAGTACGG - Intronic
952977148 3:38706087-38706109 AAGTATTACAATGGGGAGTGGGG - Intronic
956268052 3:67420131-67420153 CAGGAGAAAAATGGGGAAAATGG + Intronic
956804188 3:72792425-72792447 CTGGATTAACATGGGGAGCTTGG - Intronic
956935571 3:74096946-74096968 CAGGATGAAAAGGAAGAGTAAGG + Intergenic
960746071 3:120890297-120890319 CAGGAATAAAGTGGGAGGTAGGG + Intergenic
962330025 3:134469965-134469987 CAAGATTAAACTGGTGAGGAAGG - Intergenic
964464950 3:156981650-156981672 TAGGATTAAGTTGAGGAGTATGG + Intronic
971491060 4:27212424-27212446 CCAGATTAAAATAGGAAGTAAGG - Intergenic
971639286 4:29108993-29109015 CAGGATTTAAATGTGAAGTCTGG + Intergenic
972077173 4:35103158-35103180 CAGGATGACAATAAGGAGTAAGG + Intergenic
972337411 4:38119746-38119768 GAGGATGGAAATGGGGAGGAGGG + Intronic
972767937 4:42168983-42169005 TAGAATAAAAATGGGGAGTAAGG - Intergenic
974262256 4:59541151-59541173 CAAGAGGAAAATGGGCAGTATGG - Intergenic
976085829 4:81406328-81406350 CAGGATGAAACTGGAAAGTATGG - Intergenic
976132956 4:81904416-81904438 CAGCTGTAAAATGGGGAGGATGG + Intronic
977805524 4:101293198-101293220 GAGGATTCAAATGGGGAAAAGGG - Intronic
977837085 4:101657669-101657691 GAGGATGAACATGGGGAGAAGGG - Intronic
980779829 4:137480935-137480957 CAGGATTACAATTGGGGGCAAGG + Intergenic
981790240 4:148527981-148528003 CAGTGTTAAAATGGATAGTATGG + Intergenic
982584902 4:157223131-157223153 AAAGCTTAAAATGGGGAGGAGGG - Intronic
983139348 4:164129471-164129493 CAGCATTAAAATTGGAAGGAAGG - Intronic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
986663398 5:10078989-10079011 CATGTTTAAAATGGGGAGAAAGG + Intergenic
987797773 5:22652096-22652118 AAAGATTAAAATGTGAAGTATGG + Intronic
987850585 5:23348633-23348655 CAGGAGTAAAATAGCTAGTAAGG - Intergenic
987864824 5:23525341-23525363 CAGGATGAAGGTGGGGAGCACGG + Intronic
992414385 5:76538843-76538865 GAGGATGGAAATGGGGAGCAAGG + Intronic
995473521 5:112526530-112526552 CAGGATTACAATTGGGGGCAAGG + Intergenic
996973037 5:129396105-129396127 CAGGAGTAAATAGGGAAGTAAGG - Intergenic
997598235 5:135121272-135121294 GAGGATTAGAATGGGGAGTGAGG + Intronic
1001316574 5:170645240-170645262 CAGGCTTTAAATGGGGAACAGGG + Intronic
1003357824 6:5391143-5391165 CAGTATTAAAAGGGGCAATAGGG - Intronic
1007358701 6:41340667-41340689 AAGTATAAAAATTGGGAGTAGGG - Intronic
1009983839 6:70758720-70758742 CAGGATTAAATTGGAGAGATTGG + Intronic
1010424427 6:75711564-75711586 AGGGATTAAAATGGGAAGAATGG + Intronic
1010631381 6:78202513-78202535 AAGGCTTAAAATGGGGAGTTTGG + Intergenic
1010919199 6:81660668-81660690 CATGATGAAAATGAGGACTAGGG - Intronic
1011747416 6:90419654-90419676 CAGAACCAAAATGGGGAGGAGGG - Intergenic
1012199490 6:96387810-96387832 GAAGATAAAAATGGGAAGTATGG - Intergenic
1013613861 6:111822972-111822994 CAGGGTAAAAACGGGGTGTAAGG + Intronic
1015731187 6:136349826-136349848 CAGGAGTAAGGTGAGGAGTAGGG + Intronic
1015976941 6:138800017-138800039 CAAGATCAAAATGGGGAGGGGGG - Intronic
1021565899 7:22016094-22016116 CAGCATCAAATTGGGGAGTGAGG + Intergenic
1023429900 7:40079893-40079915 TAGGATTGATTTGGGGAGTAGGG + Intronic
1024185047 7:46940830-46940852 CAGGATGAGAATGGGGGGTTAGG + Intergenic
1024618045 7:51132507-51132529 CAGGATTAAGATTGTGAGTAGGG - Intronic
1026402056 7:70024131-70024153 CAGAATTATAATGGGGAATGGGG - Intronic
1026631200 7:72039700-72039722 CAGGCTTAGAAGGAGGAGTAAGG + Intronic
1026853687 7:73739475-73739497 GAGTATGAGAATGGGGAGTATGG - Intergenic
1026916255 7:74121773-74121795 CAGGAACCAAATGGGGAGTCTGG + Exonic
1027651274 7:80871968-80871990 CAGGATTAAAATGGTGTATTAGG - Intronic
1029260106 7:99296413-99296435 CAGGTGTAAAATGAGGAGTTTGG - Intergenic
1030279653 7:107758959-107758981 TAGGATTATAATGGTGAGGAGGG - Exonic
1030863488 7:114668342-114668364 AAGGGTTAAAATATGGAGTATGG - Intronic
1031030639 7:116730569-116730591 TAGGATGAAAATTGGGAGGAAGG + Intronic
1036530906 8:9585957-9585979 CAGCATTAAAATGGGAATGAGGG + Intronic
1038006160 8:23432427-23432449 CAGCATTAAATTGAGGAGTGGGG - Exonic
1038138741 8:24819753-24819775 GAGGATTAAAAGAGAGAGTATGG - Intergenic
1039429416 8:37514006-37514028 CTGGATTACAAGGGGGGGTATGG + Intergenic
1039623684 8:39025400-39025422 CAGGGTGAACATGAGGAGTAAGG - Intronic
1044429988 8:92096772-92096794 AAGGAATAAAATGGGGATGAAGG + Intronic
1045777721 8:105825366-105825388 CATCACTAAAATGGGGAGTCCGG - Intergenic
1046785343 8:118259782-118259804 CAGGTACAAAGTGGGGAGTAAGG - Intronic
1048502875 8:134994583-134994605 CAGATTTAAGAAGGGGAGTATGG + Intergenic
1048846206 8:138605602-138605624 CAGAATTAAATTGGAGGGTATGG + Intronic
1052073857 9:24116959-24116981 CAGAATAAAAATGTGGAGAAGGG - Intergenic
1058452219 9:105107660-105107682 CAGGATTAAAATAGAGACTTGGG + Intergenic
1058760894 9:108131034-108131056 CAGGTTTCAAATGGTGAGCAAGG + Intergenic
1059845576 9:118272069-118272091 CAGCTTTAAAATGGGGACCATGG - Intergenic
1060874124 9:127067845-127067867 CAGGCTTAAAAGGAGGAGTTCGG - Intronic
1190426161 X:50336062-50336084 CAGGATTACAATTGGGGGCAAGG - Intronic
1191793284 X:64993748-64993770 CAGGTTTAAAATGAAGAGGAGGG - Intronic
1192845873 X:74906661-74906683 CAGGAATCATATGGGGAATATGG + Intronic
1195400059 X:104452009-104452031 CAGGAATAAAAGGGGGATTCTGG - Intergenic
1195757360 X:108212525-108212547 CAGGATTAGTATGTGGGGTAGGG + Intronic
1197268578 X:124401938-124401960 CAGCATTGAAATGAGGAGTCAGG + Intronic
1199065999 X:143418798-143418820 CAGCATTCAAATGGGGAGAAGGG + Intergenic
1201554827 Y:15256911-15256933 CAGGATTACAAAGGGGGGCAAGG + Intergenic
1201852762 Y:18505629-18505651 TTGGATTAAAATGCCGAGTAGGG - Intergenic
1201880559 Y:18814755-18814777 TTGGATTAAAATGCCGAGTAGGG + Intronic