ID: 1150631344

View in Genome Browser
Species Human (GRCh38)
Location 17:66882546-66882568
Sequence TGGGCTCTTTCTCCTTTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 371}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150631344 Original CRISPR TGGGCTCTTTCTCCTTTTCA AGG Intronic
901085008 1:6605149-6605171 TTAGCTCTTTCTTTTTTTCAGGG - Intronic
902924927 1:19689807-19689829 AGGGCTCTCTGTCCTATTCAAGG - Intronic
903165645 1:21518576-21518598 TGAGCTCTTTCTTTTTTTTATGG + Intronic
904096273 1:27980502-27980524 TGGCCTCTTAATCCTTTTAAAGG - Intronic
904420983 1:30391532-30391554 TATTCTCTTTCTCCTTTTCTTGG - Intergenic
906979179 1:50609849-50609871 TGTTCTCTTTATTCTTTTCATGG - Intronic
907634562 1:56120739-56120761 TGGCCTCTTTGTCCTTATCTTGG - Intergenic
907751514 1:57267837-57267859 TGGGCTCTCTGTCTTTTCCATGG + Intronic
909736219 1:78966208-78966230 TGGCCTCTCTCTCCTGTTCTGGG + Intronic
911156242 1:94640272-94640294 TGGGCTCTTTTTACTTTTGTTGG - Intergenic
912419780 1:109535224-109535246 TGGGCTCTGTCCCCTTCTCTGGG - Intergenic
912702363 1:111887941-111887963 TGGGACTTTTCTCCTTTTCCAGG - Intronic
913174374 1:116260758-116260780 TGTGCCCTATCTCCTTTTCTGGG - Intergenic
914326160 1:146618875-146618897 AGGGCTCTCTCTCCTGTTCTGGG + Intergenic
914572268 1:148929432-148929454 TGGGCTCTTTCTCTATTACTAGG + Intronic
915083754 1:153370218-153370240 CCAGCTCTTTCTCCTTCTCAGGG - Intergenic
916973574 1:170049869-170049891 TGGTTTTTTTCTCATTTTCATGG - Intronic
917222750 1:172748979-172749001 TGGGCTCTCTCTCTGTTGCAGGG + Intergenic
917476905 1:175376641-175376663 TTGTCCCTTTCTCTTTTTCATGG + Intronic
921013527 1:211166175-211166197 TGGGGTCTTTGTGCCTTTCATGG + Intergenic
921649204 1:217656960-217656982 GGGGATTTTTCTCCTTTACACGG + Intronic
922791950 1:228315760-228315782 TTGGCTCTTTGTAGTTTTCAGGG + Intronic
922862410 1:228830535-228830557 TGGGCTCTGACTGCTTTCCAGGG + Intergenic
923670656 1:236037861-236037883 TGTGCTATTTCTCCATCTCAGGG - Intronic
923926272 1:238630455-238630477 TGGCCTCTTTTTCATTTTAAAGG + Intergenic
1065044389 10:21733519-21733541 AGGGCTCTTACTGCTGTTCAAGG - Exonic
1065681706 10:28241700-28241722 TCGGGTCTTTCTCTTTTTTATGG - Intronic
1065724029 10:28653146-28653168 TGAGCTCATTCTCCCGTTCATGG + Intergenic
1066179255 10:32943811-32943833 TTGGCTTTTTCTCTTTTTCTTGG - Intronic
1067098242 10:43316310-43316332 AGCACTTTTTCTCCTTTTCATGG - Intergenic
1067532926 10:47087544-47087566 TGGGCTCTCTCTTCTGTTCCAGG + Intergenic
1068095911 10:52490941-52490963 TAGTCTCTTTCTCCTTCACAAGG + Intergenic
1068257374 10:54530626-54530648 TGGGCTGTTTCTGCTATTGAGGG - Intronic
1068478940 10:57563985-57564007 AGGTTTCTTTCTCCTTTTCCAGG - Intergenic
1069189743 10:65471367-65471389 TGGGATTTTTCTCCATATCATGG + Intergenic
1070654310 10:78260859-78260881 TGGGTCCTTTCTTCCTTTCAGGG + Intergenic
1070933001 10:80273932-80273954 GGGTTTCTTTCTCCATTTCAAGG + Intronic
1071058203 10:81535816-81535838 TAGTCTCTTTCTGCTTGTCAAGG - Intergenic
1072610187 10:97012745-97012767 TGGGCTCTTGCTTCCTGTCATGG + Intronic
1073897276 10:108177230-108177252 TGGGCCCTTTCTCCTATTTGTGG + Intergenic
1074793335 10:116914562-116914584 TTGGTTCTTTCTCCCTCTCAAGG - Intronic
1074868934 10:117562200-117562222 TGACCTCCTTCTCCATTTCAAGG + Intergenic
1074888029 10:117710141-117710163 TGGCCCCTTTCTCTTTTTTATGG + Intergenic
1075869737 10:125762245-125762267 TATGCTCTTTCACCTCTTCAGGG - Intronic
1077405671 11:2381494-2381516 TGGGGTCTGTCTCCTTGTCTGGG - Intronic
1077903535 11:6510761-6510783 AGGAGTCTTTATCCTTTTCAAGG + Intronic
1077934742 11:6771596-6771618 AGGGCTCTGTCTCCGTTTCAAGG - Intergenic
1078054202 11:7994077-7994099 TTGTCTCTGTCTCCTTTCCATGG + Intronic
1078077556 11:8175511-8175533 TGGGCTCTGTTTCCCTTGCAGGG - Intergenic
1078182135 11:9020709-9020731 TGGGGTCTTACTCCTCCTCAAGG - Intronic
1078789739 11:14530347-14530369 TGGGCAATTTCTACTTTTTATGG + Intronic
1078929414 11:15901641-15901663 TGGGCTCCTCCTCCTTCACAGGG - Intergenic
1080214818 11:29828100-29828122 TTGATTCTTTCTCATTTTCATGG - Intergenic
1081897361 11:46598040-46598062 TGGGCTCTCTCTCCTTCCCTGGG - Intergenic
1082099490 11:48160552-48160574 TGTGCTTTTTTTCTTTTTCAAGG + Intronic
1082627314 11:55501289-55501311 TGGGCCCTTGCTCCTTACCATGG - Intergenic
1083510805 11:63208281-63208303 TGGGCCCTTGCTCCTTACCATGG - Intronic
1084458899 11:69285373-69285395 TGGGCTCCTTCTCAATCTCAGGG + Intergenic
1087192901 11:95274554-95274576 GGGGCTCTTCCTCCTTTGCTTGG + Intergenic
1087768608 11:102182482-102182504 TTTGCTTTCTCTCCTTTTCATGG + Intronic
1088171454 11:107002135-107002157 TTGGCTCTCTTTCCTTTTCTGGG - Intronic
1088877872 11:113950986-113951008 TGGCCTCTCTCTCCTGTTCTGGG - Intergenic
1090073380 11:123563043-123563065 TGGGCTCCTTCTCCTCTGAACGG - Intronic
1090195573 11:124813770-124813792 TGTGCTCTATCTCTTTTTAAAGG - Intergenic
1090322092 11:125855273-125855295 TTGGTTCTTTCTTCTTTTCTTGG - Intergenic
1090602996 11:128391896-128391918 TGGACTCTCTCTCCTCTTCAGGG - Intergenic
1091407084 12:215712-215734 TCCCCTCTTTCTCCTTTTTATGG - Intergenic
1091502684 12:1034067-1034089 TGGGTTCTTTTTCTTTTTCTTGG + Intronic
1091919727 12:4294540-4294562 TGGGCTCTGTCTCTTTTTCTTGG + Intronic
1092181474 12:6449905-6449927 TAAGCTCTTTCTACTTTTCATGG + Intronic
1092765138 12:11846145-11846167 TGGGCCCTTTCTGCCTTTGATGG - Intronic
1093716223 12:22385341-22385363 TGGGCTATTTATCCTCTTTATGG - Intronic
1096030424 12:48409310-48409332 TTGGCTCCCTGTCCTTTTCAAGG + Intergenic
1096860810 12:54526786-54526808 TTGGCACTTTTTCCTTTACACGG + Intronic
1099272416 12:80527638-80527660 TGTGCTTTTTCTCCTTTTTCTGG - Intronic
1099927546 12:89036222-89036244 AGGGCTCTTTCTGATTTGCACGG + Intergenic
1100467130 12:94856089-94856111 TGGCCTCTGTCTCCCTTTCTAGG - Intergenic
1101862165 12:108491568-108491590 GGGACTCTTTCTCCATTTCTTGG - Intergenic
1104010378 12:124925996-124926018 TTGGCTCTTTCTCATTTTCCTGG + Intergenic
1105688260 13:22808368-22808390 TGGGTTGTTTATCTTTTTCACGG - Intergenic
1106668021 13:31872959-31872981 GGTGTTCTTTCTCCTGTTCAAGG + Intergenic
1107102764 13:36611964-36611986 TTGGCTCCTACTCATTTTCAGGG + Intergenic
1108877692 13:55067769-55067791 TGGGCTCTTTCTTCTCTTCCAGG + Intergenic
1109222347 13:59653149-59653171 TATGCTCTTTCCACTTTTCAAGG + Intergenic
1110251785 13:73388258-73388280 TGGGCCCTTTCTCCTTTGAGTGG - Intergenic
1112954690 13:105043126-105043148 GGGGCTTTTTCTCCTTTGCTTGG - Intergenic
1113847092 13:113398466-113398488 GGGGCTTTTTCTTCTGTTCAGGG + Intergenic
1113981894 13:114282757-114282779 TAGCCTCTTTTTCCTTTTCTGGG - Intronic
1113992138 14:16035915-16035937 TGAGCTGTTTCTCCCTCTCATGG - Intergenic
1117018033 14:51539059-51539081 TGGGCTTTTTCTATTTTTGATGG + Intronic
1118438880 14:65794968-65794990 TCAGCTCTTTCTACTTCTCAAGG - Intergenic
1118693184 14:68359642-68359664 TGAGTTCTTTCACCTTTTGAGGG + Intronic
1118808035 14:69254700-69254722 TGGGCTATTTGGCATTTTCATGG + Intergenic
1119024587 14:71142449-71142471 TGGGTTCTTTCCCCTCCTCATGG - Intergenic
1119124752 14:72115438-72115460 TGGTCTCTTGCTGCCTTTCAAGG + Intronic
1119998871 14:79280548-79280570 TCTGCTCTTTATCCTTTTAATGG + Intronic
1120367318 14:83587772-83587794 TGTGCTCTTTCTGCTGTTCTTGG + Intergenic
1123223319 14:106876707-106876729 CCAGCTCTTTCTCTTTTTCAGGG - Intergenic
1123470634 15:20549593-20549615 AAGGCTCTTTCTCATTCTCAGGG - Intergenic
1123647426 15:22451107-22451129 AAGGCTCTTTCTCATTCTCAGGG + Intergenic
1123730935 15:23144571-23144593 AAGGCTCTTTCTCATTCTCAGGG - Intergenic
1123749074 15:23341997-23342019 AAGGCTCTTTCTCATTCTCAGGG - Intergenic
1124281445 15:28365880-28365902 AAGGCTCTTTCTCATTCTCAGGG - Intergenic
1124301259 15:28545741-28545763 AAGGCTCTTTCTCATTCTCAGGG + Intergenic
1124861703 15:33448387-33448409 TGGCCTCCTTCACCCTTTCAGGG - Intronic
1125174944 15:36810367-36810389 TGGGTTCTTTCTCACTTTTAAGG - Intergenic
1125309716 15:38365484-38365506 AGGATTCTTTCTCATTTTCAGGG + Intergenic
1126276190 15:46884106-46884128 GGGGCGCTTTCTCTTTCTCAGGG + Intergenic
1126345726 15:47692050-47692072 TGGGCTCTTTTCCCATGTCAGGG - Intronic
1126393418 15:48184365-48184387 TGAGTTCTTTTTCTTTTTCAGGG - Intergenic
1127546102 15:59995422-59995444 TGGGCGCATTCTCCCTTTCTTGG + Intergenic
1127761694 15:62146061-62146083 TAGGCTCTTTCTACCTTCCAAGG + Intergenic
1128931864 15:71712407-71712429 TGAGCTCTTTCTTCTTTTCCAGG - Intronic
1129195103 15:73959745-73959767 TGTGCTTTTTTTCCTTTTTATGG + Intergenic
1129556500 15:76515871-76515893 TGGGCTGTCTCTCCTCTTAAGGG - Intronic
1129916744 15:79281017-79281039 TGTGTTCTTTTTCCTTTTTAGGG - Intergenic
1130290666 15:82597681-82597703 CCAGCTCTTTCTCTTTTTCAGGG + Intronic
1131993229 15:98110183-98110205 TGGGCTCTATCTCCAGTTCCTGG + Intergenic
1132213689 15:100047033-100047055 GGGGCTCATTCTCTTTCTCAGGG - Intronic
1133100546 16:3476510-3476532 TGGGCTCTTTCCACCTCTCAGGG + Intronic
1133642639 16:7732533-7732555 AGGGCGCTTTCTCCTCTTGATGG - Intergenic
1133797799 16:9060364-9060386 TTGGCTCTTTCTTCTTTTCTTGG + Intergenic
1135147652 16:19976835-19976857 TGGGGTCATTCTCCTGTTGATGG + Intergenic
1135227561 16:20674818-20674840 TGGGCCCTTTCTCCTTACCGCGG - Intronic
1135767439 16:25189773-25189795 TGGCTTATTTCTCCTTTTCTGGG + Intergenic
1137983005 16:53085534-53085556 TGGGTTCTTTCTGCTTTCAAGGG + Intronic
1139300420 16:65941010-65941032 TGGGCTCTCTCTCTTATTCCAGG + Intergenic
1140007407 16:71092071-71092093 AGGGCTCTCTCTCCTGTTCTGGG - Intronic
1141302973 16:82835354-82835376 TGGTCTCTTCTTCCTTTTTAAGG + Intronic
1141421663 16:83921589-83921611 CAGGCTCTTTCTCCTTATGATGG - Exonic
1142430636 16:90024647-90024669 CCAGCTCTTTCTCTTTTTCAGGG + Intronic
1144195827 17:12893931-12893953 TGCCTTCCTTCTCCTTTTCAGGG + Intronic
1144227630 17:13165904-13165926 TGGGTTCTTTTTCTCTTTCATGG + Intergenic
1144327987 17:14200039-14200061 AGGGTTCTTTATCCTTTGCAAGG + Intronic
1144384207 17:14733921-14733943 TGGGTTCCATCTCCTTTCCAGGG - Intergenic
1146266315 17:31455349-31455371 TGGATTTATTCTCCTTTTCATGG + Intronic
1147550160 17:41435963-41435985 TGTGTGCTTTCTCCTTTTCAGGG + Intergenic
1149615354 17:57993084-57993106 TAGGCACTTTCTACTTCTCAAGG - Intronic
1150631344 17:66882546-66882568 TGGGCTCTTTCTCCTTTTCAAGG + Intronic
1152013865 17:77736765-77736787 TGGGCTCTTTTTCCTGATCACGG + Intergenic
1152284790 17:79406019-79406041 TGGCCCCTTGCCCCTTTTCATGG + Intronic
1153730746 18:8009340-8009362 TGGGCTCTTTCAGGCTTTCAGGG - Intronic
1155586584 18:27373177-27373199 TGGGGTCTTTCTGCTTGTGATGG + Intergenic
1156008735 18:32471705-32471727 TGGGATCATTCTCGTTTTCTAGG + Intergenic
1156277143 18:35594277-35594299 TGAGTTTTTTCTCCTTTTTAAGG - Intronic
1156625983 18:38909639-38909661 TGAGCTCTTTCTTGTTTTCATGG - Intergenic
1156722772 18:40090326-40090348 TGGGCCCTTTCTCAGTTCCAGGG + Intergenic
1156848160 18:41693724-41693746 TGTGCTCTTTCTTTTTCTCACGG - Intergenic
1157436639 18:47675938-47675960 TGGCCTCTTTCTCCTCTAAAAGG + Intergenic
1158366375 18:56741827-56741849 TTGGCTCTTTTCCCTTTTTAAGG + Intronic
1159523481 18:69557468-69557490 TTAGTTCTTTCTCCTTTTCAAGG - Intronic
1159912198 18:74156288-74156310 TGAAATCTTTCTCCTCTTCAGGG - Intronic
1160191172 18:76715016-76715038 TATGCTCTTTCTCCTGTACAGGG - Intergenic
1161509912 19:4664604-4664626 TGAGCTGCTTCTCCTTTTCCTGG + Intronic
1161784578 19:6315830-6315852 TGGGCTCATTCTTTTTTTAATGG - Intronic
1162530042 19:11230737-11230759 TGGGCTCTCTCTGCTATTCCTGG - Intronic
1162967942 19:14164704-14164726 TGAGGTTTTCCTCCTTTTCAGGG - Intronic
1163400964 19:17092122-17092144 TGGGCTCTTTCTTCTGCTCCCGG - Intronic
1164260248 19:23563070-23563092 TGGGCTCTTTCTCTGTGTGAGGG + Intronic
1164566946 19:29332736-29332758 AGGGCTCCTTCTCATCTTCAGGG - Intergenic
1165984806 19:39758676-39758698 TTGGCTCTGTCTCTATTTCAGGG - Intergenic
1166119719 19:40678474-40678496 TTGTCTCTTTTTCCTTTTTAAGG - Intronic
1166378423 19:42341967-42341989 TCTCCTCTCTCTCCTTTTCAGGG - Intronic
1166546817 19:43639219-43639241 TGGTCTCTGTCCCCTTTTCCTGG - Intronic
1166968679 19:46547363-46547385 GGGGCTCTTTCCCCTTTACTGGG + Intronic
1167027596 19:46932418-46932440 TTGTTACTTTCTCCTTTTCAAGG + Intronic
1168271760 19:55253899-55253921 TGGGCTGTGTCTCCTTTTCACGG - Intronic
1168404044 19:56101631-56101653 AGGGCTTTTTCTTTTTTTCAAGG + Intronic
926038930 2:9657236-9657258 TAGGCACTTTCTCTTTGTCAAGG - Intergenic
926405177 2:12544101-12544123 TGGGCTATTTCTCCTACTCTAGG + Intergenic
926833223 2:16988205-16988227 TGTGCTATATCACCTTTTCATGG + Intergenic
929297189 2:40261624-40261646 TGGGCTCTTTCTCCACTGAATGG - Intronic
929912334 2:46100787-46100809 TGTGCTCTTCTTCCTTGTCATGG - Intronic
930799934 2:55433517-55433539 TGGGCTTTTTCCCCATTTCCTGG + Intergenic
930937314 2:56969796-56969818 TGGGCTCTTAAGCCTTCTCAGGG - Intergenic
931549864 2:63431105-63431127 TGTGGGCTTTATCCTTTTCATGG + Intronic
932074681 2:68651735-68651757 TGGGCTCTGTCTCCGTTCCCAGG - Intronic
932290295 2:70571249-70571271 AGGGCTCTATCTCATTTTCCTGG + Intergenic
932494091 2:72138069-72138091 TGGGCGGTTTCTCCATCTCACGG - Intronic
934975803 2:98801286-98801308 TGGGTTCTCTCTCTTTTTCCTGG - Intronic
935465710 2:103395599-103395621 TGGGCACTTTCTCCATTTTCTGG + Intergenic
935809316 2:106781518-106781540 TGGGCACCATCTCCTTTTGAGGG + Intergenic
936068452 2:109349596-109349618 TGGGGTCTGTCTCCTTAGCAAGG - Intronic
936348446 2:111693231-111693253 TGTGTTCTTTCTCCTGTTGATGG - Intergenic
937308016 2:120884153-120884175 TGGGCGCTCTCTCCCCTTCATGG - Intronic
937664125 2:124464802-124464824 TGGTGTGTTTCTCCTTTTGAAGG + Intronic
939699131 2:145367507-145367529 TGTGATCTTGTTCCTTTTCATGG + Intergenic
940406258 2:153305849-153305871 GGGACTCTATCTCCTTTTAAAGG + Intergenic
941565253 2:167098654-167098676 TGGGCTTTTCCTCATCTTCATGG + Intronic
942530556 2:176905289-176905311 TGGGTTCTTTCTGCCTTTCAGGG + Intergenic
943611362 2:190038706-190038728 GGTGCTTTTTCTCCTTTTCCAGG + Intronic
943716076 2:191153151-191153173 TGTTCTCCTCCTCCTTTTCAGGG + Intergenic
944780052 2:203008513-203008535 GGGGCGCATTCTCCTTCTCAGGG - Intronic
948149543 2:235734106-235734128 AGGGCTGATTGTCCTTTTCAAGG + Intronic
948692761 2:239717286-239717308 TGGGATTTTTTTTCTTTTCAGGG + Intergenic
1168780588 20:486101-486123 TGGTGTATTTTTCCTTTTCATGG + Intronic
1170877088 20:20260044-20260066 TTGCCTCTTTTACCTTTTCAGGG + Intronic
1172125234 20:32621652-32621674 TGGGAGCTTTCTCTTGTTCAAGG - Intergenic
1172133987 20:32675021-32675043 TGGCCTTTTTTTCCTTTTGAAGG - Intergenic
1172919449 20:38469002-38469024 TTTGCTGTTTCTCCTCTTCAGGG - Intergenic
1174543577 20:51308388-51308410 TGGGCTCTGTCTGCTTCTCTGGG - Intergenic
1177367478 21:20156204-20156226 GGGGCTATTTCTCCTTTGCTTGG + Intergenic
1178139666 21:29668512-29668534 TGGCCTCTTTCTCCTCTTGCTGG - Intronic
1178170879 21:30038573-30038595 TGGCCTCTTTTTCCTTTTATAGG + Intergenic
1179003162 21:37482799-37482821 GGGGCTCATTCTCTTTCTCAGGG + Intronic
1179056814 21:37944021-37944043 TGGTCTCCTTCACCTTTTCCTGG + Intergenic
1180315133 22:11271612-11271634 TGAGCTGTTTCTCCCTCTCATGG + Intergenic
1181938240 22:26454177-26454199 TGGGATTTTTCTCCCTTACAGGG - Intronic
1182994975 22:34803572-34803594 TGGGGTCTTTCTCTTTCTCTGGG + Intergenic
1183856436 22:40637898-40637920 GGGGTTATTTCTCCTTTTCTGGG - Intergenic
1183974587 22:41503876-41503898 TGCCCTCTTTCTCCGTGTCAGGG - Intronic
1184735589 22:46395857-46395879 TGGGCTCTGTACCCTTTGCACGG - Intronic
1185151816 22:49168042-49168064 TTGGCTCTTGCTCCTTAGCAGGG - Intergenic
949402080 3:3675800-3675822 TCTGCTCTTTCACATTTTCAAGG - Intergenic
951398184 3:22197276-22197298 TAGGCTCCTTCTCCTCTTCTAGG + Intronic
952658031 3:35809620-35809642 TGGGCTTTTTTTCTTCTTCAGGG + Intergenic
952910778 3:38183043-38183065 TTGCCACTTTCTCCTTTTTAGGG - Exonic
952978184 3:38713965-38713987 CGGGCTCTTTCTCGATTTGAAGG - Exonic
953374918 3:42420633-42420655 TGATGTCTTTCTCCATTTCAGGG - Intergenic
953446900 3:42976244-42976266 TGGAATCTTTCTCCTCCTCACGG - Intronic
954272237 3:49519000-49519022 AGGACCCTTTCTCCTTATCAGGG + Intronic
954939749 3:54360789-54360811 TGGCCCCTCTCTACTTTTCAGGG - Intronic
954983563 3:54768906-54768928 AGGGTTCCTTCTCCTCTTCATGG + Intronic
957654162 3:83050323-83050345 TGGACTCTGTCTCCTTGTCTGGG + Intergenic
958082692 3:88767424-88767446 TGGGATCTTTATCCAGTTCATGG - Intergenic
958863262 3:99469823-99469845 TGGGACCTTTCTCCTTTGCCTGG - Intergenic
960083009 3:113561237-113561259 AGGGCTCTTTATCCTTTCCTGGG + Intronic
961124051 3:124399917-124399939 AAGGCACTTTTTCCTTTTCAGGG + Intronic
962048123 3:131783086-131783108 TGGTTTCTTTCTTCTTTTTATGG - Intronic
962197928 3:133379730-133379752 TTCTCTCTGTCTCCTTTTCAAGG + Exonic
963544754 3:146642702-146642724 TTGGCTCTTTTTCCTTTTTCTGG + Intergenic
963957077 3:151265851-151265873 GGGTCTCTTGGTCCTTTTCAGGG + Intronic
964275892 3:155008688-155008710 GAGGCTCTTTCTCCTTTGCTAGG - Intergenic
964695220 3:159500409-159500431 TGGTCTCTTTTTTCTTTTAAGGG - Intronic
964758485 3:160110851-160110873 GGGGCTCATTGTACTTTTCATGG - Intergenic
965930636 3:174038836-174038858 TGGCTTCCTTCTTCTTTTCAGGG + Intronic
967978149 3:195046760-195046782 TGGGTTAATTCTCCTTTTCCAGG - Intergenic
968020444 3:195382674-195382696 TTGGCTCTTTATCCTCTTCTTGG - Intronic
968635245 4:1675125-1675147 TGGCCTTTGTCTCCTTTTCCGGG - Intronic
969277759 4:6148521-6148543 CGGGCGCATCCTCCTTTTCAAGG + Intronic
969284572 4:6194881-6194903 TGGCCCCTTTATCCTTTCCAGGG - Intronic
969899632 4:10336795-10336817 TGGGGACTTTCTCCTTCTCCTGG + Intergenic
970065132 4:12084932-12084954 AGGGCTCTGTCTCCTTTTTATGG + Intergenic
970071042 4:12160668-12160690 TTTACTCTATCTCCTTTTCAAGG + Intergenic
971167345 4:24197709-24197731 GTGGCACTTTCTCCTTTGCAAGG - Intergenic
971842025 4:31865013-31865035 TTTATTCTTTCTCCTTTTCATGG - Intergenic
973890056 4:55359681-55359703 TTGGCTCTGTCTCCTTCTCAGGG - Intronic
974642198 4:64645700-64645722 TGAGCTCTGTTTCCTTTTCTGGG + Intergenic
975897033 4:79105914-79105936 TTGGTTCTTTCTCATCTTCATGG + Intergenic
975980150 4:80147822-80147844 TAGGCTCCTTTTCCTTGTCAGGG - Intergenic
976180067 4:82390555-82390577 TTGGGTCTTTCCCCTTTTTAAGG - Intergenic
976396288 4:84559291-84559313 TGGGCTCATTCTCCTTCTAGTGG - Intergenic
977360081 4:95991753-95991775 TGGGCTCTTCTTCTTTTTCTAGG - Intergenic
977942362 4:102873036-102873058 GGGGCTCTTCCTCCTTTGCTCGG - Intronic
978346378 4:107774290-107774312 TTGGTTGTTTCTCCTGTTCAGGG + Intergenic
978515257 4:109561616-109561638 TGGGCTTTTTATACTTTTAAAGG + Intronic
979073808 4:116244743-116244765 GGGGCTTTTCCTCCTTTTCTGGG + Intergenic
980404860 4:132343793-132343815 TTGTTTCTTTCTCATTTTCATGG + Intergenic
981972228 4:150677940-150677962 TGGCCTATTTCTACTTTTAATGG - Intronic
982993008 4:162303109-162303131 TTGGCGCTTTCTCCTTTCCAAGG + Intergenic
983550262 4:169010267-169010289 CGAGCTCTTCCTCCTTTTCACGG - Intronic
984057355 4:174946562-174946584 TTGTCTTTTTCTCATTTTCAAGG + Intronic
984207786 4:176806870-176806892 TGGGCTCATCCTCCTCTTCCTGG - Intergenic
984348533 4:178562466-178562488 GGGGCTCTTTCCCCTTTGCTTGG - Intergenic
984352747 4:178616412-178616434 TTGGCTTTTTTTCCTTTTCCTGG - Intergenic
984609265 4:181819394-181819416 TGTGTTCTTTCTCCCTTTCCAGG - Intergenic
985748486 5:1661227-1661249 TGGTCTCTATCTCACTTTCAGGG - Intergenic
985855400 5:2420664-2420686 GGGGCACTTTCTCCTTCTCCGGG + Intergenic
986025700 5:3848647-3848669 TGGGCACTTTCTGCTTTGCAGGG + Intergenic
987032544 5:13989109-13989131 ACGGCTCTTTCTGCTTTTCTTGG - Intergenic
988078792 5:26388906-26388928 TGTGCTCATTATCTTTTTCATGG - Intergenic
988827920 5:34958301-34958323 TGGGCTCTTTATTCTCGTCAGGG - Exonic
990485017 5:56249632-56249654 TTGGCTCTTTCACCTTGCCAAGG + Intergenic
991709143 5:69390285-69390307 TGTGCTCTTTCTGCTGTTCAAGG + Intronic
992150915 5:73901975-73901997 TGGCCTCTTCCTGCTTGTCAGGG + Intronic
993260084 5:85646999-85647021 TTTTCTCTTTCTCCCTTTCAAGG + Intergenic
993885795 5:93413432-93413454 TGGGCTCTCTCATCTCTTCAGGG + Intergenic
994336290 5:98570065-98570087 TAGTCTATTTCTCCCTTTCAAGG - Intergenic
994927704 5:106139740-106139762 TGGGCTGTTTCTAGTTTTCCTGG - Intergenic
995266756 5:110171216-110171238 GGGGCTTTTTCCCCTTTTCTTGG + Intergenic
996242629 5:121221960-121221982 TGGGTTCTTCCTCATCTTCATGG - Intergenic
996706625 5:126504736-126504758 TGGGTCATTTCTCCTTTTGAGGG + Intergenic
997350097 5:133224905-133224927 TGGGCTCTGTCTGCTGTCCAGGG + Intronic
997670297 5:135665854-135665876 TGGGCTCTTTCTCTCCTTCCAGG + Intergenic
997709741 5:135993962-135993984 TGAGCTCTTTCTCCTCTTGCTGG - Intergenic
998038419 5:138935723-138935745 GGGGCTCCTTCTCCTTTCCTGGG + Intergenic
999093256 5:148955869-148955891 GGGGCGCATTCTCCTTCTCAGGG + Intronic
999472086 5:151864024-151864046 TTGGCTCTTTGTCCTGTTGATGG + Intronic
999940611 5:156538645-156538667 TGAGCTCTTTCTGCTTATCTAGG + Intronic
1000592247 5:163172148-163172170 GGGGCTTATTTTCCTTTTCATGG - Intergenic
1003003154 6:2356217-2356239 TGGTCTTTTTCTTCTTTTCAGGG + Intergenic
1005783680 6:29219830-29219852 TGTGATCTTGTTCCTTTTCATGG + Intergenic
1007382229 6:41497953-41497975 TGGGCCCTTGCTCCTTCTCTGGG - Intergenic
1007898891 6:45391720-45391742 AGGGCTCTTTCCCCTTTGCTTGG - Intronic
1007915463 6:45557314-45557336 TGTGCACTTTCTGCATTTCAGGG - Intronic
1010105724 6:72164845-72164867 TGGTCTCTTTCTTCTTATAAAGG + Intronic
1010618367 6:78041968-78041990 TGGGGTCTTCCCCATTTTCAGGG - Intergenic
1011000635 6:82584284-82584306 GGGACTTTTTCTCCTTTTCCTGG - Intergenic
1011224535 6:85092366-85092388 TGGGCTCTGTCTTGTATTCATGG - Intergenic
1012083094 6:94785418-94785440 TGGCCTCTGTCCCCTTTCCAGGG + Intergenic
1012866577 6:104625397-104625419 TGGGGTCCTTCTCCTTCACAAGG + Intergenic
1013531651 6:111024776-111024798 TTGGTTCTCTCTCCTTTTCCTGG - Intronic
1013860216 6:114626410-114626432 TGTGATCTTATTCCTTTTCATGG + Intergenic
1014926862 6:127282350-127282372 TGGGCATTTACTCATTTTCATGG + Intronic
1016187303 6:141212459-141212481 TGGCCTCTCTCTCCTCTTCCAGG - Intergenic
1016361961 6:143276894-143276916 TGAGATGTTTCTCCTCTTCAAGG - Intronic
1016663902 6:146612110-146612132 TGGCCTCTTTTACCTTTTCCTGG + Intronic
1017289656 6:152721090-152721112 TGGGCTCTTTCTTGTTTCCCAGG - Intronic
1017402310 6:154078427-154078449 TGGGTTCTTTTTCCCTTTCTTGG - Intronic
1018729076 6:166635660-166635682 CGGGCTCTTCCTCCTCTTCTGGG - Intronic
1018750014 6:166796212-166796234 TGGTCTTTTTGTCTTTTTCAGGG - Intronic
1018837965 6:167499272-167499294 TCTGCACTTTATCCTTTTCATGG + Intergenic
1020272425 7:6605284-6605306 TGGCCTCTTTTTCCTTTTTTTGG + Intronic
1020920462 7:14257601-14257623 TGGGCTTTTTCCCCTTTGCTTGG + Intronic
1021056627 7:16056195-16056217 GGGGCTCTTTCCCCTTTGCTTGG - Intergenic
1022272381 7:28821753-28821775 TGCACTCTTTCTCCTTTTTGTGG - Exonic
1022413467 7:30157561-30157583 GGGGCTCACTCTCCTTCTCAGGG - Exonic
1026604623 7:71805211-71805233 TGGGCTCTTCCACCTTCTGATGG + Intronic
1027939151 7:84650675-84650697 TGGTCTATTTCTAGTTTTCACGG - Intergenic
1028380298 7:90192453-90192475 CGGGATTTTTCTCCTTTTCCTGG + Intronic
1029328771 7:99833571-99833593 CCAGCTCTTTCTCTTTTTCAGGG + Intronic
1031494924 7:122434262-122434284 TGTGTTCTTTCTCCTCTTCGTGG + Intronic
1031958599 7:127968104-127968126 TTTCCTCTCTCTCCTTTTCAGGG + Intronic
1032483097 7:132262450-132262472 TGGGCTTTTTCCCCTTTCCATGG + Intronic
1033771846 7:144560950-144560972 TGTGCTCTTTCTGCTTTTTTAGG + Intronic
1034535640 7:151724255-151724277 TGGGCTCTTTCTGCATTTGGGGG + Intronic
1036526110 8:9536227-9536249 TAGGCTCTTTCACTTTTTCTAGG - Intergenic
1036607749 8:10322608-10322630 TGGGCTGTTTCTGCCTTGCAGGG + Intronic
1037278337 8:17205685-17205707 TAAGTTCTTTCTCCTTTTCTTGG + Exonic
1037627825 8:20623518-20623540 TAATCTCTTTCTCCTTTTGAGGG + Intergenic
1037872243 8:22509408-22509430 TGAGCTCCTTCTCCTCTTCCAGG - Intronic
1038065020 8:23954959-23954981 AGGCCAGTTTCTCCTTTTCATGG + Intergenic
1038975259 8:32688254-32688276 AGTGCTCTTTATACTTTTCATGG + Intronic
1039118238 8:34116260-34116282 TGTGCCCTTCCTCCTTCTCATGG - Intergenic
1039333853 8:36568437-36568459 TAGGATCTTTCTGCTGTTCATGG + Intergenic
1039796996 8:40924208-40924230 TTAGATCTTTCTCCTTTTCCGGG - Intergenic
1040125959 8:43738079-43738101 TAGCTTCTTTCTCCTTTTCCTGG - Intergenic
1040542264 8:48370744-48370766 AGTTCACTTTCTCCTTTTCAGGG + Intergenic
1040687716 8:49895569-49895591 TTCTCTCTTTCTCCCTTTCATGG + Intergenic
1042641395 8:70938968-70938990 TGGGCTTTTTTTTTTTTTCAGGG + Intergenic
1042945285 8:74147944-74147966 TGGGCTCTACCTACCTTTCAAGG + Intergenic
1042972441 8:74425004-74425026 TTGGATCCTTCTCCTTTTGAGGG + Intronic
1044130945 8:88524370-88524392 AATGTTCTTTCTCCTTTTCAAGG - Intergenic
1047365848 8:124210708-124210730 TGGGTTCTTTCTCTGTTTCTAGG + Intergenic
1047467061 8:125127125-125127147 TGGACATTATCTCCTTTTCATGG + Intronic
1048024661 8:130574959-130574981 TGGGTTCTTCCTCTTGTTCATGG + Intergenic
1048748313 8:137641457-137641479 AGGGCTCTTCCCCCTTTTCCTGG + Intergenic
1050066547 9:1765788-1765810 TGGCTTCTTTCTCCCCTTCATGG - Intergenic
1050506000 9:6350298-6350320 TAGGCTCTTCCTCCTAGTCAGGG - Intergenic
1050617443 9:7416952-7416974 TGTGCTCCTTCTCCTTATGAGGG + Intergenic
1050663000 9:7903901-7903923 TGGGTTGTTTCTTATTTTCATGG - Intergenic
1050663819 9:7912881-7912903 TCGGCTCTTTCTCTCTTTCATGG - Intergenic
1051524869 9:18032095-18032117 TGGGCTCTTCCACGTGTTCAGGG + Intergenic
1051991353 9:23156003-23156025 TCGTCTCTTTCTCCTTTACTAGG + Intergenic
1056191648 9:84190121-84190143 TGGCCTCTCTCTCCTGTTCTGGG + Intergenic
1056437196 9:86586185-86586207 TTTGCTTTTACTCCTTTTCAAGG - Intergenic
1056880147 9:90383720-90383742 TGGTCTCTCTCTGCTTTACAGGG - Intergenic
1057233167 9:93337481-93337503 GGGGCTCTTTCCCCTTTGCTCGG + Intronic
1057672663 9:97107785-97107807 TGGGCTGAATCTCCTTTCCATGG + Intergenic
1059351509 9:113668681-113668703 TGTGCTTTTTCTAGTTTTCATGG - Intergenic
1059504353 9:114784314-114784336 TGGCCTCTCTTTCTTTTTCAGGG + Intergenic
1059980513 9:119766619-119766641 TGGGATCTTTCTGTTTTTAAAGG - Intergenic
1061417674 9:130455983-130456005 AGGGCTCTTTCTCCCCTTCCTGG - Intronic
1062732024 9:138115412-138115434 AGGGCTCTTTCCCCTTAGCAAGG - Intronic
1203363418 Un_KI270442v1:237521-237543 TGAGCTGTTTCTCCCTCTCATGG + Intergenic
1187083584 X:16018054-16018076 TGTACTAATTCTCCTTTTCAGGG + Intergenic
1187191578 X:17040615-17040637 TAAGCTCTGTCTCCTTTTCTAGG + Intronic
1187238870 X:17494594-17494616 TGTACCCTTTCTCCTTTTCTGGG + Intronic
1187724743 X:22190761-22190783 TGGAAACTTGCTCCTTTTCATGG - Intronic
1187738286 X:22326785-22326807 TGGGATCTGTCACCTTCTCATGG + Intergenic
1187976086 X:24707129-24707151 TGAGCTCATTCTCTTCTTCATGG - Intronic
1188124131 X:26346896-26346918 TGAGTTCTTTATCCTTTTCCTGG + Intergenic
1188355160 X:29181926-29181948 TGGTCTTTTTCTCCATTTCTTGG + Intronic
1188859857 X:35244029-35244051 TGTGCACTTTCTCCTGTCCAAGG - Intergenic
1189745472 X:44163958-44163980 TGGATTCTTTCTCCAGTTCAGGG + Exonic
1190628204 X:52357855-52357877 TAGGCTTTTTCTCATTTTTAGGG + Intergenic
1190642421 X:52493612-52493634 TAGGCTGTTTTTCATTTTCAAGG + Intergenic
1190645252 X:52519255-52519277 TAGGCTGTTTTTCATTTTCAAGG - Intronic
1190953239 X:55166633-55166655 TAGGCTTTTTCTCATTTTCAGGG + Intronic
1190992621 X:55567231-55567253 TTGATTCTTTCTCATTTTCATGG - Intergenic
1190999149 X:55641650-55641672 TAGGCTTTTTCTCATTTTCAGGG - Intergenic
1191088129 X:56591002-56591024 TGGTCTCATTCTCTTTTTTATGG + Intergenic
1191685849 X:63889842-63889864 TGGGCTCTTTTTTCATTGCAGGG - Intergenic
1191919881 X:66244276-66244298 TTTGCTCTCTCTCTTTTTCAGGG + Intronic
1192260415 X:69503180-69503202 TTGGCTCTTTCATCTTTCCAGGG + Intergenic
1192628627 X:72756813-72756835 TGTGCTCCTTCTCCTTATGAGGG - Intergenic
1192653081 X:72964001-72964023 TGTGCTCCTTCTCCTTATGAGGG + Intergenic
1193506407 X:82349556-82349578 GGGGCTCTTTTTCCTTTGCTTGG - Intergenic
1193878304 X:86890964-86890986 TTGGCTCTTTCTTCATTTCATGG - Intergenic
1194203133 X:90979046-90979068 TGGCTTCAGTCTCCTTTTCAGGG + Intergenic
1194521335 X:94921903-94921925 TGAGATCATTCTCCTTTGCAGGG + Intergenic
1195097740 X:101521434-101521456 TGGGATCTCTCTCTTTTTCTTGG + Intronic
1195498648 X:105567903-105567925 TGGGCTTTTTTTCCTTTTTAGGG - Intronic
1198532121 X:137557718-137557740 TTAACTCTTTCTCCTTTTTAAGG - Intergenic
1198600294 X:138277008-138277030 TGGTTTGTTTTTCCTTTTCACGG + Intergenic
1198736934 X:139796351-139796373 TGGGCTCCTTCTTCATCTCATGG - Exonic
1198957348 X:142147422-142147444 TGGGATCTTTCACATTTCCAAGG + Intergenic
1199056881 X:143307175-143307197 TCGGCACTTACTCATTTTCATGG + Intergenic
1200548965 Y:4554472-4554494 TGGCTTCAGTCTCCTTTTCAGGG + Intergenic
1201571871 Y:15423670-15423692 TGGGCTCTTACTCCTTACCATGG - Intergenic