ID: 1150631650

View in Genome Browser
Species Human (GRCh38)
Location 17:66884565-66884587
Sequence TGAGATGCTCAACAGGACCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 168}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150631643_1150631650 30 Left 1150631643 17:66884512-66884534 CCAGGCCTCTCTCTCGTGGTGGG 0: 1
1: 0
2: 0
3: 13
4: 174
Right 1150631650 17:66884565-66884587 TGAGATGCTCAACAGGACCAAGG 0: 1
1: 0
2: 1
3: 10
4: 168
1150631645_1150631650 25 Left 1150631645 17:66884517-66884539 CCTCTCTCTCGTGGTGGGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 164
Right 1150631650 17:66884565-66884587 TGAGATGCTCAACAGGACCAAGG 0: 1
1: 0
2: 1
3: 10
4: 168
1150631647_1150631650 7 Left 1150631647 17:66884535-66884557 CCTGGTGCTCTACATCTCCAGCA 0: 1
1: 0
2: 3
3: 31
4: 258
Right 1150631650 17:66884565-66884587 TGAGATGCTCAACAGGACCAAGG 0: 1
1: 0
2: 1
3: 10
4: 168
1150631648_1150631650 -10 Left 1150631648 17:66884552-66884574 CCAGCATCAACGATGAGATGCTC 0: 1
1: 0
2: 1
3: 4
4: 37
Right 1150631650 17:66884565-66884587 TGAGATGCTCAACAGGACCAAGG 0: 1
1: 0
2: 1
3: 10
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150631650 Original CRISPR TGAGATGCTCAACAGGACCA AGG Exonic
902810521 1:18885481-18885503 TGAGATCCTCGCCAAGACCATGG - Exonic
906490917 1:46267776-46267798 TGAGTTGCTCAGCAGATCCAAGG - Intronic
906728937 1:48064697-48064719 TGGGATGCTCCACAGGACACAGG - Intergenic
907096838 1:51789733-51789755 TCAGATGCTAAGCAGGTCCAGGG - Intronic
912185362 1:107268690-107268712 TGAAATGCTCAATAGGAACTTGG - Intronic
915216420 1:154343535-154343557 AGAGCTGCTCAACACCACCATGG + Exonic
917016431 1:170536367-170536389 AGAGATGCTCATCACCACCAAGG + Intronic
918154155 1:181829746-181829768 TTGGATTCTCAACAGGGCCATGG - Intergenic
920874789 1:209824429-209824451 TGAGATTCTCAACAGAGCTAGGG - Intergenic
920906737 1:210177030-210177052 TGAGATCCTAAACAGGATCCTGG - Intergenic
922616938 1:226966124-226966146 TGAGTTGCTGAACAGCCCCAGGG - Intronic
923198986 1:231693895-231693917 TGAGAAGCTCGACAGGGCCTGGG + Exonic
924069473 1:240261593-240261615 AGTGGTGCTCAGCAGGACCAGGG - Intronic
1066614020 10:37278424-37278446 TCGGATTCTCAACAGGGCCATGG + Intronic
1067479850 10:46587578-46587600 CGAGATGCTCAGCAAGCCCAAGG + Exonic
1067614887 10:47754219-47754241 CGAGATGCTCAGCAAGCCCAAGG - Intergenic
1068466453 10:57399270-57399292 TAAGATGCTAAACAGAAACAGGG + Intergenic
1068500867 10:57838906-57838928 TCAGATTCTCAACAAGGCCATGG - Intergenic
1070313855 10:75293274-75293296 TGAGAGGCTCATCTGGGCCAGGG + Intergenic
1070415599 10:76186486-76186508 CAAAATGCTCAAGAGGACCAGGG - Intronic
1070955456 10:80460661-80460683 GCAGATGCTGAAAAGGACCAAGG - Intronic
1071369194 10:84933987-84934009 TCTGATACTCAATAGGACCAAGG - Intergenic
1071630294 10:87214183-87214205 CGAGATGCTCAGCAAGCCCAAGG - Intergenic
1073175772 10:101556420-101556442 TGAGAAGGTCAACAGTACCAAGG - Exonic
1073513857 10:104060164-104060186 GGAGCTGCTCATCATGACCAAGG - Exonic
1074038792 10:109767521-109767543 TGATATGCCCAAAAGGAGCAAGG + Intergenic
1077331978 11:1987846-1987868 GGAGATGGACAACAGGACCGAGG - Intergenic
1077331989 11:1987885-1987907 GGAGATGGACAACAGGACCGAGG - Intergenic
1077332000 11:1987924-1987946 GGAGATGGACAACAGGACCGAGG - Intergenic
1077960598 11:7072928-7072950 TGAGATAATGAACAGGACAAGGG - Intergenic
1081012066 11:37826033-37826055 TCATGTGCTCAACAGTACCATGG - Intergenic
1081258178 11:40923503-40923525 TGAGAAGATAAACAGGAACATGG - Intronic
1082766636 11:57173797-57173819 TGAGATTCTATAAAGGACCAAGG + Intergenic
1085739615 11:79067677-79067699 TGACTGGCTCAACAGGATCATGG - Intronic
1086280789 11:85185506-85185528 TGAGATACTCTACATGAGCATGG - Intronic
1087682778 11:101234445-101234467 TCAGATTCTCAACAGGGCCATGG + Intergenic
1091275867 11:134349679-134349701 AAAGATGCTCAACATCACCAGGG - Intronic
1202814959 11_KI270721v1_random:43022-43044 GGAGATGGACAACAGGACCGAGG - Intergenic
1202814970 11_KI270721v1_random:43061-43083 GGAGATGGACAACAGGACCGAGG - Intergenic
1202814981 11_KI270721v1_random:43100-43122 GGAGATGGACAACAGGACCGAGG - Intergenic
1092547657 12:9466128-9466150 TGAGATGCTAAAGATGGCCACGG - Intergenic
1092969399 12:13677473-13677495 TGTGAAGCTACACAGGACCAGGG - Intronic
1093298748 12:17426786-17426808 TGATATACTTGACAGGACCAAGG - Intergenic
1093345823 12:18037499-18037521 TCGGATTCTCAACAGGGCCATGG - Intergenic
1093568772 12:20641261-20641283 AGAGGAGCTCAACAGTACCAGGG + Intronic
1094505326 12:31056234-31056256 TGAGATGCTAAAGATGGCCACGG + Intergenic
1098486548 12:71028181-71028203 TTAGATTCTCATAAGGACCACGG - Intergenic
1099376807 12:81902638-81902660 TCAGATTCTCAACAAGACCATGG - Intergenic
1101530004 12:105565077-105565099 AGAGATGCTCAAATTGACCAGGG + Intergenic
1102577370 12:113864364-113864386 TCAGATGCTCAAGAAGACTATGG + Intronic
1103197194 12:119054976-119054998 TGTGATGCTTAAAATGACCAGGG + Intronic
1107204849 13:37772056-37772078 TGAGAGGTTTACCAGGACCATGG + Intronic
1109228512 13:59726541-59726563 TGAGTTGGTTAACTGGACCAGGG - Intronic
1112302269 13:98240953-98240975 TGAGATGCACAGCAGGACTCTGG + Intronic
1114408483 14:22478459-22478481 GGGGTTGGTCAACAGGACCACGG + Intergenic
1116725988 14:48562058-48562080 TCAGATTCTCAACAGGGCAATGG - Intergenic
1117178644 14:53170466-53170488 TGGGATGTTCACCAGTACCAAGG + Intergenic
1121665582 14:95669700-95669722 AGAGGTGCTCAGCAGGCCCAGGG - Intergenic
1123158477 14:106253388-106253410 GGAGATGCTCATCATGATCAAGG - Intergenic
1124601457 15:31136111-31136133 GGAGATGGCCAACATGACCATGG - Intronic
1129304342 15:74648050-74648072 TGAGATGCTGACCAGCTCCATGG + Intronic
1129363067 15:75036646-75036668 TGAGAGGCTTAACAGGACCCCGG + Intronic
1129704995 15:77789064-77789086 TGAGATGCTCACCACCGCCAAGG + Intronic
1130132025 15:81151771-81151793 TGAGGTGCACAACAGACCCAAGG - Intergenic
1131911617 15:97211383-97211405 TGAGATGCTCAAAATGACCAAGG + Intergenic
1132415398 15:101615413-101615435 AGAGTTGCTCAGCAGGACAAAGG + Intergenic
1140295581 16:73706516-73706538 TGTGATGCTCTTCAGGGCCATGG - Intergenic
1142145683 16:88492012-88492034 AGAGATGCTCAGGAGGAGCAGGG - Intronic
1144857508 17:18277868-18277890 TGGGATGCCCACCAGGCCCAGGG - Exonic
1147758161 17:42781690-42781712 TGAGGGGATCAAGAGGACCAGGG - Intronic
1147795658 17:43040653-43040675 TCAGATGGTCTACAGGACCCAGG + Intergenic
1147875280 17:43616615-43616637 GGAGATGCTCAGCAGCTCCAAGG + Intergenic
1150631650 17:66884565-66884587 TGAGATGCTCAACAGGACCAAGG + Exonic
1151524788 17:74657525-74657547 TGACAAGCTCAACAGCCCCAGGG - Intergenic
1152661204 17:81543022-81543044 TGACATGCTCATCAGGGTCATGG + Intronic
1155497957 18:26461115-26461137 TGAGAAGCACAAGATGACCATGG + Intronic
1156368195 18:36448744-36448766 TGAGATGCTGAAAAGGAGCCTGG + Intronic
1158309178 18:56140317-56140339 TGAGAAGCTCACCAGGGCAAAGG + Intergenic
1160183945 18:76660375-76660397 TCAGCTGCTCATCAGGTCCAGGG + Intergenic
1160907860 19:1460221-1460243 TGAGATGCACAAGATGACCCGGG + Exonic
1163337327 19:16681818-16681840 TGAGATGTACTACTGGACCAGGG - Intronic
1164626697 19:29734052-29734074 TGAGAAGCCCAAGAGGACCAGGG + Intergenic
925309795 2:2874492-2874514 TGAGATGCTCAGGAGCCCCAGGG - Intergenic
926286820 2:11495154-11495176 TGAGATGCTCAACATGGCTCAGG - Intergenic
927423716 2:22958171-22958193 GAAGATGCTCTACAGCACCAGGG - Intergenic
931842179 2:66165032-66165054 TGACATGGCCAAGAGGACCAAGG + Intergenic
933817158 2:86077338-86077360 TGAGAAGCGAAACAGGACCTGGG + Intronic
935391782 2:102560394-102560416 TAAGATGCTCAAGAGGACCTGGG + Intergenic
940256808 2:151739505-151739527 TGAGATCCTAAAGAGGACCCAGG + Intergenic
940564260 2:155340236-155340258 TGAGATGAACCACAGGCCCATGG - Intergenic
941808437 2:169733371-169733393 TGATGTGCTCACCAGCACCAAGG + Intronic
942385860 2:175442127-175442149 TGAGATGCTCTTCATGACCCTGG + Intergenic
944121634 2:196246760-196246782 TGAGATGCTTAAAAGGACGTGGG + Intronic
945247822 2:207736145-207736167 TTATATGCTGAAAAGGACCACGG - Intronic
945758112 2:213875425-213875447 TGAGAAGGTCAACAGCATCAAGG + Intronic
946858596 2:223978328-223978350 AGAGAAGCTAAACAGGACCAGGG - Intronic
948614307 2:239188515-239188537 TGAGATGCTCACGTGGTCCATGG - Intronic
948641481 2:239378403-239378425 TCACATGCTCAACGTGACCACGG + Intronic
948918436 2:241050425-241050447 TGAGATGCTGAACAGGTCTGGGG - Intronic
1171256326 20:23691344-23691366 TGAGATGGTCACCAGGACTCAGG - Intergenic
1173103885 20:40113193-40113215 TGAGGTTCTCAACAGGGCTAGGG - Intergenic
1173935336 20:46857167-46857189 TGTGATTCTCAAAAGGATCAAGG - Intergenic
1177135610 21:17303035-17303057 TTAGATTCTCAACAAGGCCATGG - Intergenic
1180741150 22:18054024-18054046 TGGGATGCTCTGCAGCACCAGGG - Intergenic
1181542496 22:23580691-23580713 TGAGATGCTCCACAGACCCAGGG - Intergenic
1182870272 22:33640334-33640356 GGAGGTTCTGAACAGGACCAGGG + Intronic
949609980 3:5693972-5693994 TCAGATTCTCAACAGGGCAATGG + Intergenic
949742186 3:7249156-7249178 TGAGATTCTCAAGAAAACCATGG - Intronic
950654534 3:14428343-14428365 AGAGATGCTCAGCAGGGCCTCGG + Intronic
950904339 3:16524219-16524241 TGAGCTGCCAAATAGGACCAGGG + Intergenic
954403969 3:50334872-50334894 TCGGATGCACAGCAGGACCATGG + Intronic
956726493 3:72160868-72160890 TGAGAGGCTCAGGAGGCCCAGGG + Intergenic
961245320 3:125446732-125446754 TCAAATGCTAAACAGGACTAGGG + Exonic
961484300 3:127206664-127206686 TGAGATGCTCACATGGCCCAGGG + Intergenic
963791332 3:149585656-149585678 TGAGATGCTCATTACCACCAAGG - Intronic
968575290 4:1363250-1363272 GGAGATGCTCACCGGGACCAGGG + Intronic
975730821 4:77335541-77335563 TCAGATTCTCAACAAGACAATGG + Intronic
977180866 4:93872178-93872200 TTAGTTGCTCAACAGGAGAAAGG - Intergenic
977884723 4:102242299-102242321 TTGGATTCTCAACAGGGCCATGG - Intergenic
978015360 4:103738102-103738124 TGAGATGCTCATCATGGCCTGGG + Intergenic
983397257 4:167215495-167215517 TGAGATACGTAACAGGACAAAGG + Intronic
983956826 4:173707733-173707755 TGCGATGCTCAGCAGGAGCCAGG + Intergenic
986788568 5:11138744-11138766 GGAGCTACACAACAGGACCAAGG + Intronic
990529984 5:56663779-56663801 TGAGAAGCTCAGCAGGAGCCAGG - Intergenic
991729766 5:69573975-69573997 TGTGAGGATCTACAGGACCAAGG - Intronic
991806198 5:70429115-70429137 TGTGAGGATCTACAGGACCAAGG - Intergenic
991865188 5:71053899-71053921 TGTGAGGATCTACAGGACCAAGG + Intronic
992049923 5:72932519-72932541 TCAGATTCCCAACAGGGCCATGG - Intergenic
993733630 5:91450426-91450448 TCAGATGCTAAGCAGAACCAGGG - Intergenic
993996264 5:94727192-94727214 GGAGGTGGTCAGCAGGACCAGGG + Intronic
995158220 5:108941722-108941744 TGAGATGCTCATCAGGAAGCTGG + Intronic
996680762 5:126226369-126226391 TCAGATTCTCAACAAGGCCATGG - Intergenic
997072849 5:130639189-130639211 TCAGATTCTCAACAAGGCCATGG - Intergenic
997354697 5:133254793-133254815 TGTGAGGCTCAACAGGATGATGG - Intronic
998713319 5:144850658-144850680 TCAGATTCTCAACAAGGCCATGG + Intergenic
1007764292 6:44151917-44151939 TGGGATGCGCAGCAGGTCCATGG - Exonic
1011190445 6:84721852-84721874 TGACATGCTGCACAGGACTATGG + Intronic
1012221462 6:96653900-96653922 TGTGATGCTAAAAAGCACCAGGG - Intergenic
1015768955 6:136749540-136749562 TGAAATGCTCATCAGCACCTAGG + Intronic
1017802615 6:157911303-157911325 TGAGATGCTCACCTGAACCTAGG + Intronic
1020688640 7:11327344-11327366 TGAGATTCTTAACAGGATCTTGG - Intergenic
1020957820 7:14763951-14763973 AGAGAGGCTCAATGGGACCATGG + Intronic
1022275190 7:28847893-28847915 TGAGATGCTCAGCTAGGCCAGGG - Intergenic
1022963923 7:35455472-35455494 TCAGATTCTCAAAAGGACCTGGG - Intergenic
1023882358 7:44327561-44327583 TGAGAAGCTGCCCAGGACCAGGG + Intronic
1024862402 7:53861100-53861122 AAACCTGCTCAACAGGACCATGG - Intergenic
1026935045 7:74249704-74249726 GGAGACACTCAACAGGCCCAGGG + Intronic
1027791564 7:82642680-82642702 TCAGATTCTCAACAAGGCCATGG - Intergenic
1028494703 7:91450134-91450156 TCAGATTCTCAACAAGGCCATGG + Intergenic
1028768272 7:94585061-94585083 TGGGTTGCTCAACTGGAACACGG + Intergenic
1028835530 7:95370399-95370421 TGAGTTGATCAAAAGGGCCAGGG + Intronic
1031103467 7:117511111-117511133 AGAGAAGCTCAGCAGAACCAAGG - Intronic
1033681828 7:143602835-143602857 CGAGAAGCTCATCAGAACCAAGG + Intergenic
1033703061 7:143859078-143859100 CGAGAAGCTCATCAGAACCAAGG - Exonic
1034162815 7:149005368-149005390 TGAGTTGCTGAAAGGGACCAAGG + Exonic
1034542677 7:151768994-151769016 TGAGATGCTCCAAAGCTCCATGG + Intronic
1034706568 7:153151126-153151148 TGAGCTGCACAACAGGACTAGGG - Intergenic
1040649462 8:49432344-49432366 TCAGATTCTCAACAAGGCCATGG - Intergenic
1041002447 8:53465808-53465830 TCAGATTCTCAACATGGCCATGG - Intergenic
1041476296 8:58271040-58271062 TGATATGATGGACAGGACCAGGG + Intergenic
1042501300 8:69512360-69512382 TGAAATGAACAACAGGGCCATGG + Intronic
1044018541 8:87075713-87075735 TGAGATGAGCAGCAGGACCTAGG + Intronic
1046328229 8:112678138-112678160 TCAAATGCTTAACAGGAGCAAGG - Intronic
1050222969 9:3416599-3416621 AGTGATTCTCAACAGCACCAGGG - Intronic
1051618190 9:19026936-19026958 GGAGGTGCTCAACATGTCCACGG + Intronic
1052057253 9:23919652-23919674 TCAGATTCTCAACAAGGCCATGG + Intergenic
1055678618 9:78691641-78691663 TGAGCTGCTCATCATGAACAGGG - Intergenic
1057656185 9:96954883-96954905 TGAGCTGCACACCAGCACCATGG + Intronic
1057726054 9:97568902-97568924 TGAGATGCTCAAGGAGAACAAGG + Exonic
1058938169 9:109788641-109788663 TGTGATGCACATCAGGACCCAGG - Intronic
1060170026 9:121453695-121453717 TGACAGCCTCACCAGGACCACGG - Intergenic
1062446871 9:136598857-136598879 TGAGCAGCCCAACAGGCCCAGGG - Intergenic
1186920071 X:14269110-14269132 TGAGATGCTGGACAAGATCAGGG - Intergenic
1187015020 X:15318136-15318158 TGAAATCATCAACAGCACCAAGG + Intergenic
1187134337 X:16532241-16532263 GGACATGCTAAACAGCACCATGG - Intergenic
1195267325 X:103195317-103195339 TGAGATGTTGAACTGGACCCAGG + Intergenic
1196489261 X:116247918-116247940 TCAGATTCTCAACAAGGCCATGG - Intergenic
1196724000 X:118879313-118879335 CGCGGTGCTCAACATGACCATGG + Intergenic
1201404256 Y:13634102-13634124 TCAGATTCTCAACAAGGCCATGG - Intergenic
1201907809 Y:19103344-19103366 TCAGATTCTCAACAAGGCCATGG + Intergenic