ID: 1150632682

View in Genome Browser
Species Human (GRCh38)
Location 17:66891009-66891031
Sequence GTGGGGAGACAGTTGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150632673_1150632682 30 Left 1150632673 17:66890956-66890978 CCAAGGAAGAATAAGATTTATGC No data
Right 1150632682 17:66891009-66891031 GTGGGGAGACAGTTGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150632682 Original CRISPR GTGGGGAGACAGTTGGAGGA AGG Intergenic
No off target data available for this crispr