ID: 1150633801

View in Genome Browser
Species Human (GRCh38)
Location 17:66898718-66898740
Sequence TGCAGCTGAGGCAGCTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150633801_1150633813 29 Left 1150633801 17:66898718-66898740 CCCTGGGAGCTGCCTCAGCTGCA No data
Right 1150633813 17:66898770-66898792 GCCCTGGGCAGTCCATATCCAGG No data
1150633801_1150633810 14 Left 1150633801 17:66898718-66898740 CCCTGGGAGCTGCCTCAGCTGCA No data
Right 1150633810 17:66898755-66898777 CCTTGGTCATGCCCTGCCCTGGG No data
1150633801_1150633808 13 Left 1150633801 17:66898718-66898740 CCCTGGGAGCTGCCTCAGCTGCA No data
Right 1150633808 17:66898754-66898776 CCCTTGGTCATGCCCTGCCCTGG No data
1150633801_1150633804 -3 Left 1150633801 17:66898718-66898740 CCCTGGGAGCTGCCTCAGCTGCA No data
Right 1150633804 17:66898738-66898760 GCAGAGCGCCACCTCGCCCTTGG No data
1150633801_1150633815 30 Left 1150633801 17:66898718-66898740 CCCTGGGAGCTGCCTCAGCTGCA No data
Right 1150633815 17:66898771-66898793 CCCTGGGCAGTCCATATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150633801 Original CRISPR TGCAGCTGAGGCAGCTCCCA GGG (reversed) Intergenic