ID: 1150636257

View in Genome Browser
Species Human (GRCh38)
Location 17:66915315-66915337
Sequence CTGCAGAAGTGGGAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150636248_1150636257 10 Left 1150636248 17:66915282-66915304 CCCAGGAGGGGGAGCCTCTGCCT No data
Right 1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG No data
1150636249_1150636257 9 Left 1150636249 17:66915283-66915305 CCAGGAGGGGGAGCCTCTGCCTG No data
Right 1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG No data
1150636251_1150636257 -4 Left 1150636251 17:66915296-66915318 CCTCTGCCTGCTGGAAGCTCTGC No data
Right 1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG No data
1150636252_1150636257 -10 Left 1150636252 17:66915302-66915324 CCTGCTGGAAGCTCTGCAGAAGT No data
Right 1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG No data
1150636240_1150636257 27 Left 1150636240 17:66915265-66915287 CCCACTGGCTTTGCCAGCCCAGG No data
Right 1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG No data
1150636242_1150636257 26 Left 1150636242 17:66915266-66915288 CCACTGGCTTTGCCAGCCCAGGA No data
Right 1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG No data
1150636247_1150636257 14 Left 1150636247 17:66915278-66915300 CCAGCCCAGGAGGGGGAGCCTCT No data
Right 1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150636257 Original CRISPR CTGCAGAAGTGGGAGGTGGA AGG Intergenic
No off target data available for this crispr