ID: 1150636972

View in Genome Browser
Species Human (GRCh38)
Location 17:66919828-66919850
Sequence CAGGAGGAATGAAGGGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150636972_1150636980 6 Left 1150636972 17:66919828-66919850 CCCACATCCCTTCATTCCTCCTG No data
Right 1150636980 17:66919857-66919879 CTCTTCTGCTCTGACTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150636972 Original CRISPR CAGGAGGAATGAAGGGATGT GGG (reversed) Intergenic
No off target data available for this crispr