ID: 1150637092

View in Genome Browser
Species Human (GRCh38)
Location 17:66920978-66921000
Sequence TCGATGACTTCATCTCTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150637092_1150637095 4 Left 1150637092 17:66920978-66921000 CCAGTAAGAGATGAAGTCATCGA No data
Right 1150637095 17:66921005-66921027 ACCACCCTTTGAATCTGGGCTGG No data
1150637092_1150637101 27 Left 1150637092 17:66920978-66921000 CCAGTAAGAGATGAAGTCATCGA No data
Right 1150637101 17:66921028-66921050 GCTTGTCTTGCATTGGCCAATGG No data
1150637092_1150637097 5 Left 1150637092 17:66920978-66921000 CCAGTAAGAGATGAAGTCATCGA No data
Right 1150637097 17:66921006-66921028 CCACCCTTTGAATCTGGGCTGGG No data
1150637092_1150637100 20 Left 1150637092 17:66920978-66921000 CCAGTAAGAGATGAAGTCATCGA No data
Right 1150637100 17:66921021-66921043 GGGCTGGGCTTGTCTTGCATTGG No data
1150637092_1150637093 -1 Left 1150637092 17:66920978-66921000 CCAGTAAGAGATGAAGTCATCGA No data
Right 1150637093 17:66921000-66921022 ATTTCACCACCCTTTGAATCTGG No data
1150637092_1150637094 0 Left 1150637092 17:66920978-66921000 CCAGTAAGAGATGAAGTCATCGA No data
Right 1150637094 17:66921001-66921023 TTTCACCACCCTTTGAATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150637092 Original CRISPR TCGATGACTTCATCTCTTAC TGG (reversed) Intergenic
No off target data available for this crispr