ID: 1150637100

View in Genome Browser
Species Human (GRCh38)
Location 17:66921021-66921043
Sequence GGGCTGGGCTTGTCTTGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150637092_1150637100 20 Left 1150637092 17:66920978-66921000 CCAGTAAGAGATGAAGTCATCGA No data
Right 1150637100 17:66921021-66921043 GGGCTGGGCTTGTCTTGCATTGG No data
1150637091_1150637100 21 Left 1150637091 17:66920977-66920999 CCCAGTAAGAGATGAAGTCATCG No data
Right 1150637100 17:66921021-66921043 GGGCTGGGCTTGTCTTGCATTGG No data
1150637090_1150637100 24 Left 1150637090 17:66920974-66920996 CCTCCCAGTAAGAGATGAAGTCA No data
Right 1150637100 17:66921021-66921043 GGGCTGGGCTTGTCTTGCATTGG No data
1150637096_1150637100 -8 Left 1150637096 17:66921006-66921028 CCACCCTTTGAATCTGGGCTGGG No data
Right 1150637100 17:66921021-66921043 GGGCTGGGCTTGTCTTGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150637100 Original CRISPR GGGCTGGGCTTGTCTTGCAT TGG Intergenic