ID: 1150637101

View in Genome Browser
Species Human (GRCh38)
Location 17:66921028-66921050
Sequence GCTTGTCTTGCATTGGCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150637099_1150637101 -5 Left 1150637099 17:66921010-66921032 CCTTTGAATCTGGGCTGGGCTTG No data
Right 1150637101 17:66921028-66921050 GCTTGTCTTGCATTGGCCAATGG No data
1150637091_1150637101 28 Left 1150637091 17:66920977-66920999 CCCAGTAAGAGATGAAGTCATCG No data
Right 1150637101 17:66921028-66921050 GCTTGTCTTGCATTGGCCAATGG No data
1150637096_1150637101 -1 Left 1150637096 17:66921006-66921028 CCACCCTTTGAATCTGGGCTGGG No data
Right 1150637101 17:66921028-66921050 GCTTGTCTTGCATTGGCCAATGG No data
1150637098_1150637101 -4 Left 1150637098 17:66921009-66921031 CCCTTTGAATCTGGGCTGGGCTT No data
Right 1150637101 17:66921028-66921050 GCTTGTCTTGCATTGGCCAATGG No data
1150637092_1150637101 27 Left 1150637092 17:66920978-66921000 CCAGTAAGAGATGAAGTCATCGA No data
Right 1150637101 17:66921028-66921050 GCTTGTCTTGCATTGGCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150637101 Original CRISPR GCTTGTCTTGCATTGGCCAA TGG Intergenic