ID: 1150639461

View in Genome Browser
Species Human (GRCh38)
Location 17:66939677-66939699
Sequence AAGGGGTGCTCTCCCTCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150639461_1150639469 -10 Left 1150639461 17:66939677-66939699 CCGCAGGAGGGAGAGCACCCCTT No data
Right 1150639469 17:66939690-66939712 AGCACCCCTTGGCGGGGGGGAGG No data
1150639461_1150639474 20 Left 1150639461 17:66939677-66939699 CCGCAGGAGGGAGAGCACCCCTT No data
Right 1150639474 17:66939720-66939742 AGATCTGGAAACAGAGTGCCTGG No data
1150639461_1150639473 5 Left 1150639461 17:66939677-66939699 CCGCAGGAGGGAGAGCACCCCTT No data
Right 1150639473 17:66939705-66939727 GGGGGAGGTCAGCTCAGATCTGG No data
1150639461_1150639475 21 Left 1150639461 17:66939677-66939699 CCGCAGGAGGGAGAGCACCCCTT No data
Right 1150639475 17:66939721-66939743 GATCTGGAAACAGAGTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150639461 Original CRISPR AAGGGGTGCTCTCCCTCCTG CGG (reversed) Intergenic
No off target data available for this crispr