ID: 1150639903

View in Genome Browser
Species Human (GRCh38)
Location 17:66942518-66942540
Sequence CTGGAGGGACAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150639893_1150639903 18 Left 1150639893 17:66942477-66942499 CCAGACATGAGCAACAGCAGGAA No data
Right 1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG No data
1150639898_1150639903 -9 Left 1150639898 17:66942504-66942526 CCATCAGCTCTTGTCTGGAGGGA No data
Right 1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG No data
1150639892_1150639903 19 Left 1150639892 17:66942476-66942498 CCCAGACATGAGCAACAGCAGGA No data
Right 1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150639903 Original CRISPR CTGGAGGGACAGAGGGAGGA GGG Intergenic
No off target data available for this crispr