ID: 1150640887

View in Genome Browser
Species Human (GRCh38)
Location 17:66948655-66948677
Sequence CTTACAACACACATCTAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150640879_1150640887 13 Left 1150640879 17:66948619-66948641 CCCCGGGGCCACCACAAATGACC No data
Right 1150640887 17:66948655-66948677 CTTACAACACACATCTAACAGGG No data
1150640882_1150640887 5 Left 1150640882 17:66948627-66948649 CCACCACAAATGACCACAAACGT No data
Right 1150640887 17:66948655-66948677 CTTACAACACACATCTAACAGGG No data
1150640881_1150640887 11 Left 1150640881 17:66948621-66948643 CCGGGGCCACCACAAATGACCAC No data
Right 1150640887 17:66948655-66948677 CTTACAACACACATCTAACAGGG No data
1150640880_1150640887 12 Left 1150640880 17:66948620-66948642 CCCGGGGCCACCACAAATGACCA No data
Right 1150640887 17:66948655-66948677 CTTACAACACACATCTAACAGGG No data
1150640885_1150640887 -8 Left 1150640885 17:66948640-66948662 CCACAAACGTTGTGGCTTACAAC No data
Right 1150640887 17:66948655-66948677 CTTACAACACACATCTAACAGGG No data
1150640883_1150640887 2 Left 1150640883 17:66948630-66948652 CCACAAATGACCACAAACGTTGT No data
Right 1150640887 17:66948655-66948677 CTTACAACACACATCTAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150640887 Original CRISPR CTTACAACACACATCTAACA GGG Intergenic
No off target data available for this crispr