ID: 1150641524

View in Genome Browser
Species Human (GRCh38)
Location 17:66952973-66952995
Sequence TGTGCATCCCTGTGTGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150641524_1150641532 25 Left 1150641524 17:66952973-66952995 CCAGGAACACACAGGGATGCACA No data
Right 1150641532 17:66953021-66953043 CAAGGCCAAGTGCTCTCCCTGGG No data
1150641524_1150641529 -8 Left 1150641524 17:66952973-66952995 CCAGGAACACACAGGGATGCACA No data
Right 1150641529 17:66952988-66953010 GATGCACATGGCAGGAACTGGGG No data
1150641524_1150641527 -10 Left 1150641524 17:66952973-66952995 CCAGGAACACACAGGGATGCACA No data
Right 1150641527 17:66952986-66953008 GGGATGCACATGGCAGGAACTGG No data
1150641524_1150641530 7 Left 1150641524 17:66952973-66952995 CCAGGAACACACAGGGATGCACA No data
Right 1150641530 17:66953003-66953025 AACTGGGGCTGTCACGAGCAAGG No data
1150641524_1150641528 -9 Left 1150641524 17:66952973-66952995 CCAGGAACACACAGGGATGCACA No data
Right 1150641528 17:66952987-66953009 GGATGCACATGGCAGGAACTGGG No data
1150641524_1150641531 24 Left 1150641524 17:66952973-66952995 CCAGGAACACACAGGGATGCACA No data
Right 1150641531 17:66953020-66953042 GCAAGGCCAAGTGCTCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150641524 Original CRISPR TGTGCATCCCTGTGTGTTCC TGG (reversed) Intergenic
No off target data available for this crispr