ID: 1150643394

View in Genome Browser
Species Human (GRCh38)
Location 17:66964408-66964430
Sequence GCGCGCGCGGGCGCGGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150643383_1150643394 20 Left 1150643383 17:66964365-66964387 CCTTCACTCCAATAATGTGAATG No data
Right 1150643394 17:66964408-66964430 GCGCGCGCGGGCGCGGGGAGGGG No data
1150643382_1150643394 29 Left 1150643382 17:66964356-66964378 CCTCGGCTTCCTTCACTCCAATA No data
Right 1150643394 17:66964408-66964430 GCGCGCGCGGGCGCGGGGAGGGG No data
1150643384_1150643394 12 Left 1150643384 17:66964373-66964395 CCAATAATGTGAATGAACTCTGG No data
Right 1150643394 17:66964408-66964430 GCGCGCGCGGGCGCGGGGAGGGG No data
1150643381_1150643394 30 Left 1150643381 17:66964355-66964377 CCCTCGGCTTCCTTCACTCCAAT No data
Right 1150643394 17:66964408-66964430 GCGCGCGCGGGCGCGGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150643394 Original CRISPR GCGCGCGCGGGCGCGGGGAG GGG Intergenic
No off target data available for this crispr