ID: 1150643604

View in Genome Browser
Species Human (GRCh38)
Location 17:66965094-66965116
Sequence CACCCACTCTGGTCTGTGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 267}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150643598_1150643604 -10 Left 1150643598 17:66965081-66965103 CCCGCGGCGACCTCACCCACTCT 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1150643604 17:66965094-66965116 CACCCACTCTGGTCTGTGGCGGG 0: 1
1: 0
2: 2
3: 18
4: 267
1150643597_1150643604 -5 Left 1150643597 17:66965076-66965098 CCGCGCCCGCGGCGACCTCACCC 0: 1
1: 0
2: 3
3: 17
4: 189
Right 1150643604 17:66965094-66965116 CACCCACTCTGGTCTGTGGCGGG 0: 1
1: 0
2: 2
3: 18
4: 267
1150643593_1150643604 3 Left 1150643593 17:66965068-66965090 CCGCCCCGCCGCGCCCGCGGCGA 0: 1
1: 1
2: 2
3: 42
4: 476
Right 1150643604 17:66965094-66965116 CACCCACTCTGGTCTGTGGCGGG 0: 1
1: 0
2: 2
3: 18
4: 267
1150643589_1150643604 6 Left 1150643589 17:66965065-66965087 CCCCCGCCCCGCCGCGCCCGCGG 0: 1
1: 3
2: 22
3: 178
4: 1248
Right 1150643604 17:66965094-66965116 CACCCACTCTGGTCTGTGGCGGG 0: 1
1: 0
2: 2
3: 18
4: 267
1150643592_1150643604 4 Left 1150643592 17:66965067-66965089 CCCGCCCCGCCGCGCCCGCGGCG 0: 1
1: 3
2: 24
3: 192
4: 1074
Right 1150643604 17:66965094-66965116 CACCCACTCTGGTCTGTGGCGGG 0: 1
1: 0
2: 2
3: 18
4: 267
1150643595_1150643604 -1 Left 1150643595 17:66965072-66965094 CCCGCCGCGCCCGCGGCGACCTC 0: 1
1: 1
2: 1
3: 35
4: 276
Right 1150643604 17:66965094-66965116 CACCCACTCTGGTCTGTGGCGGG 0: 1
1: 0
2: 2
3: 18
4: 267
1150643585_1150643604 29 Left 1150643585 17:66965042-66965064 CCAACCTGACCATGGACGACGGG 0: 1
1: 0
2: 0
3: 0
4: 52
Right 1150643604 17:66965094-66965116 CACCCACTCTGGTCTGTGGCGGG 0: 1
1: 0
2: 2
3: 18
4: 267
1150643587_1150643604 25 Left 1150643587 17:66965046-66965068 CCTGACCATGGACGACGGGCCCC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1150643604 17:66965094-66965116 CACCCACTCTGGTCTGTGGCGGG 0: 1
1: 0
2: 2
3: 18
4: 267
1150643591_1150643604 5 Left 1150643591 17:66965066-66965088 CCCCGCCCCGCCGCGCCCGCGGC 0: 2
1: 6
2: 33
3: 272
4: 1609
Right 1150643604 17:66965094-66965116 CACCCACTCTGGTCTGTGGCGGG 0: 1
1: 0
2: 2
3: 18
4: 267
1150643594_1150643604 0 Left 1150643594 17:66965071-66965093 CCCCGCCGCGCCCGCGGCGACCT 0: 1
1: 1
2: 0
3: 26
4: 259
Right 1150643604 17:66965094-66965116 CACCCACTCTGGTCTGTGGCGGG 0: 1
1: 0
2: 2
3: 18
4: 267
1150643588_1150643604 20 Left 1150643588 17:66965051-66965073 CCATGGACGACGGGCCCCCGCCC 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1150643604 17:66965094-66965116 CACCCACTCTGGTCTGTGGCGGG 0: 1
1: 0
2: 2
3: 18
4: 267
1150643596_1150643604 -2 Left 1150643596 17:66965073-66965095 CCGCCGCGCCCGCGGCGACCTCA 0: 1
1: 0
2: 2
3: 15
4: 187
Right 1150643604 17:66965094-66965116 CACCCACTCTGGTCTGTGGCGGG 0: 1
1: 0
2: 2
3: 18
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150643604 Original CRISPR CACCCACTCTGGTCTGTGGC GGG Exonic
900207340 1:1437183-1437205 CACCCACACTGGCCTGGCGCTGG + Exonic
900853503 1:5162463-5162485 CATCCACTCTGCTGTGTGCCTGG - Intergenic
902384147 1:16066986-16067008 CTCGCTCCCTGGTCTGTGGCTGG - Intronic
902955943 1:19924088-19924110 CTCCTGCTCTGGTCTGTGACTGG + Intergenic
903446846 1:23427819-23427841 CACCAACTCTGGTTTCTTGCTGG - Intergenic
903568314 1:24285375-24285397 CACCCACGCTGCTCTGTCTCCGG + Intergenic
903833259 1:26187348-26187370 CAGCCTCTCTGGGCTGTGGGTGG + Intronic
904162186 1:28530345-28530367 CACCCTCTCTGGGCTGTGTGAGG + Intronic
904297164 1:29527480-29527502 CACCCACTCAGATCTGTGCCAGG - Intergenic
904623867 1:31791220-31791242 CACTCACTCAAGTCTGTTGCTGG - Exonic
905464197 1:38140301-38140323 CACCCACACTGGAGTGTGCCCGG + Intergenic
905884432 1:41484250-41484272 CCCCCACTCTGGGATGTGCCAGG - Intronic
905972423 1:42152322-42152344 CACAGACTCTGGCATGTGGCAGG - Intergenic
907933396 1:59020485-59020507 CTCCTACCCTGGACTGTGGCAGG - Intergenic
912034194 1:105290811-105290833 CACCCACTGGGGCCTGTTGCGGG - Intergenic
913251586 1:116916344-116916366 CACCCACTCTGAAATGTGCCCGG - Intronic
915270374 1:154749571-154749593 CACCCTGTCTTCTCTGTGGCAGG - Intronic
915310467 1:155003716-155003738 CCCCCACTCTGGGCTGGGGCAGG - Intronic
915600847 1:156922401-156922423 CACCAACTGTGTGCTGTGGCAGG + Intronic
915865186 1:159491991-159492013 CACACACTGTAGTCTGTGGCTGG + Intergenic
916476525 1:165174718-165174740 CACCCCATCTGGTATGTTGCTGG - Intergenic
920285268 1:204874494-204874516 CACCCGCTCTGCCCTGTGACAGG + Intronic
920934379 1:210417748-210417770 CACCTACTCATGTCTGAGGCTGG - Intronic
921177650 1:212608288-212608310 CACCTAGTCTGGGCTGGGGCCGG + Intronic
922726090 1:227923707-227923729 CTCCCACCTTGGTCTGTGGGGGG + Intronic
922739936 1:228009072-228009094 CACCCACCCCGGTCAGTGTCAGG - Intronic
923540730 1:234886272-234886294 CACCCACCCTGAGCTGGGGCTGG - Intergenic
924220705 1:241872514-241872536 CACACACCCCGGCCTGTGGCAGG - Intronic
924672895 1:246147531-246147553 CACCCATTCTGGGTTGGGGCAGG + Intronic
1065323531 10:24530782-24530804 CAGCTACTCTGGGCTGGGGCAGG + Intronic
1065686421 10:28289687-28289709 AACCCACTCTGGGCTTTGGGTGG + Intronic
1066294762 10:34044388-34044410 CCCTGACTGTGGTCTGTGGCTGG + Intergenic
1067551654 10:47240607-47240629 CTGCCTCTCTGGTCTCTGGCTGG - Intergenic
1068165405 10:53325206-53325228 CACACACTGTGGCCTGTTGCAGG - Intergenic
1070786727 10:79166363-79166385 CTCCCACCCTGCTCTTTGGCGGG + Intronic
1072838169 10:98739303-98739325 CACACACTGTGGTCTGTCGTGGG + Intronic
1073072099 10:100801074-100801096 CCCACACTCTGGGCTCTGGCTGG + Intronic
1073220116 10:101864724-101864746 CACACACTGGGGTCTGTTGCAGG + Intronic
1074139498 10:110659505-110659527 CACACAATCTGGCCTCTGGCTGG - Intronic
1075637044 10:124036343-124036365 CTTCCACTCTGTTCTGAGGCAGG - Intronic
1076327093 10:129632728-129632750 AACCCACTGTGGTATGTGACTGG - Intronic
1077262164 11:1628620-1628642 GCCCCACTCTGTTCTGGGGCAGG - Intergenic
1077535209 11:3120703-3120725 AGCCCACCCTGGTCTGTGCCTGG - Intronic
1077653725 11:3998515-3998537 CACACACTCTGCTCTGTGCCGGG + Intronic
1077884749 11:6378749-6378771 CACACACACTGTTCTGTGTCAGG - Intergenic
1078451782 11:11445953-11445975 CACCCACTCTCACCTGTGGGAGG - Intronic
1078471330 11:11589217-11589239 CTTCCTCACTGGTCTGTGGCAGG - Intronic
1078524425 11:12089799-12089821 CACACACTGGGGCCTGTGGCAGG + Intergenic
1081265763 11:41019182-41019204 CACACACTGTGGCCTGTTGCGGG - Intronic
1083511428 11:63212648-63212670 CACACACTGTGGTCTGTTGTGGG + Intronic
1083855465 11:65390942-65390964 CACCCACTCTGTTCCCAGGCTGG + Intronic
1083938873 11:65884526-65884548 CACCCAACCTGGTCTGTCCCTGG - Intronic
1084425014 11:69079873-69079895 CACCCAGGCTGGTATGTGACTGG + Exonic
1084556358 11:69878591-69878613 CCCCCACTTTTGTCTCTGGCTGG + Intergenic
1084715780 11:70872602-70872624 CCCTGACTCTGGTCTGTGGGGGG - Intronic
1085395404 11:76204742-76204764 CCCCCACGCTGGCCTGTGGTGGG - Intronic
1085445499 11:76598221-76598243 CACCCACACCAGTCTGTGACAGG + Intergenic
1085946640 11:81280440-81280462 CACACACTGTGGTCTGTTGGGGG - Intergenic
1087727702 11:101741261-101741283 CACCCATTCTGGCATATGGCTGG + Intronic
1090475495 11:127016394-127016416 CACCCAGTCTGGGGTGAGGCTGG - Intergenic
1090952757 11:131487965-131487987 TACCAGCTCTGGTCTGTGCCAGG - Intronic
1091329206 11:134717400-134717422 CACCGTCTCTGGACAGTGGCAGG - Intergenic
1091605232 12:1945864-1945886 CACACACTGGGGTCTGTCGCGGG + Intergenic
1091674283 12:2477518-2477540 TCCCCACTCTGCTCTCTGGCTGG + Intronic
1091755303 12:3047418-3047440 CAGCTACTCTGGGCTGAGGCAGG + Intergenic
1092437090 12:8457918-8457940 CTGAGACTCTGGTCTGTGGCTGG + Exonic
1093991120 12:25591165-25591187 AACCCACTCTGGCCTAGGGCAGG - Intronic
1095722474 12:45415604-45415626 CACCAACTCTGGTCCTTGCCTGG + Intronic
1096656457 12:53095651-53095673 CACACACTGGGGCCTGTGGCGGG + Intergenic
1097187618 12:57204161-57204183 CTCCTTCTCTGGTATGTGGCAGG - Intronic
1099018200 12:77370945-77370967 CACCCACCCTGTTCTCTGTCTGG - Intergenic
1101080100 12:101173106-101173128 TACCCACTCTACTCTGTGCCTGG + Intronic
1102153095 12:110702240-110702262 CACCCCTTCTGGTCTGGGCCTGG + Intronic
1104518223 12:129447757-129447779 CACACACTCTGGTTTGCGGAAGG - Intronic
1105027069 12:132856433-132856455 CACACACTCTGCTCTGAGCCAGG + Intronic
1106554555 13:30798532-30798554 CACCCACTTTGGGCTTTGGGCGG - Intergenic
1107818287 13:44263866-44263888 CAACCACTGTGGTCTGTTGTGGG + Intergenic
1110880220 13:80562606-80562628 CACCCACTCTAGTCTTTAGCAGG + Intergenic
1111196265 13:84877287-84877309 TACCCACTGTGGTGTGGGGCTGG + Intergenic
1112076643 13:95921174-95921196 CACACACTGTGGTCTGTTGGGGG + Intronic
1112760603 13:102690038-102690060 CATCCTCTCAGGGCTGTGGCAGG + Intronic
1113615622 13:111678532-111678554 CAGCGACTCCCGTCTGTGGCTGG + Intergenic
1113621090 13:111763434-111763456 CAGCGACTCCCGTCTGTGGCTGG + Intergenic
1114649546 14:24275615-24275637 CAGACTCTCTGGTCTGTGACGGG - Intergenic
1117912157 14:60647091-60647113 CACCAACTCTGGGCTGGGGCAGG - Intronic
1118441008 14:65811809-65811831 CTCACAGTCTGGTCTCTGGCTGG + Intergenic
1118485002 14:66206436-66206458 CACACACTCGGGACTGTGGTGGG + Intergenic
1119769574 14:77212031-77212053 CAGCCTCTCTGTTCTGGGGCAGG - Intronic
1120131333 14:80810948-80810970 CACACACTGGGGTCTGTGGGGGG - Intronic
1122049055 14:99042820-99042842 CAACCCCTCGGGCCTGTGGCGGG - Intergenic
1122264830 14:100541689-100541711 CAGCCACTCCTGGCTGTGGCTGG - Intronic
1122699989 14:103581909-103581931 CACCCTCCCTGCTCTGTGGAGGG + Intronic
1122817147 14:104319408-104319430 CACCCACTGTGGTCTCAGCCAGG + Intergenic
1124694257 15:31850600-31850622 CAGGCTCTCTGGTTTGTGGCTGG + Intronic
1124826746 15:33104492-33104514 CAACCACCCTGGTATGTGGTTGG + Intronic
1125725708 15:41867154-41867176 CTCCCACCCTGGGCTGGGGCAGG + Intronic
1128499544 15:68218251-68218273 AACCCCCTCTGGCCTGTGTCTGG - Intronic
1129115105 15:73361256-73361278 CACCCACTCGGATCTGAGGTGGG - Intronic
1129270742 15:74418093-74418115 CACACACTCTGGGCTGTCCCGGG - Intronic
1129504596 15:76071000-76071022 CACCCAGTCTGGTTTGTCCCGGG + Intronic
1129800109 15:78407023-78407045 CACCCACTCAGGTTGGTTGCTGG - Intergenic
1130571692 15:85051629-85051651 CACACACTGAGGCCTGTGGCAGG - Intronic
1130672999 15:85929546-85929568 CACCCACTCTGGATTGTGCCTGG - Intergenic
1130726474 15:86444547-86444569 CTCCCACTCAGGTCTTAGGCAGG - Intronic
1132038519 15:98505673-98505695 GACCCTCTCTGGGCTGTGCCGGG - Intronic
1132060824 15:98691239-98691261 CACCTCTTCTGGTCTGTGACAGG + Intronic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1134055281 16:11166144-11166166 CCCACACTCAGCTCTGTGGCTGG + Intronic
1138830914 16:60373753-60373775 CACACACTGGGGTCTGTGGTTGG - Intergenic
1139547731 16:67657480-67657502 CCGCCTCTTTGGTCTGTGGCTGG - Exonic
1141261304 16:82456169-82456191 CACTTACTCTCGTCTGTGCCAGG + Intergenic
1141596517 16:85100244-85100266 CACCCACCCTGGTCTCTCCCCGG - Intronic
1141938476 16:87258222-87258244 CTCCCACTGTGGTCCTTGGCAGG + Intronic
1142499916 17:326514-326536 CACCGACTGTGCACTGTGGCTGG - Intronic
1142938316 17:3357944-3357966 CCCCCACTCTGATCTCTGCCAGG - Intergenic
1144879795 17:18425409-18425431 AACCCACCCTGGGCTGAGGCAGG - Intergenic
1144886809 17:18468750-18468772 GAGCCACCGTGGTCTGTGGCGGG - Intergenic
1145145405 17:20475546-20475568 GAGCCACCGTGGTCTGTGGCGGG + Intergenic
1145152439 17:20518975-20518997 AACCCACCCTGGGCTGAGGCAGG + Intergenic
1146603604 17:34239048-34239070 GACCCACTCTCGTGGGTGGCTGG - Intergenic
1146729805 17:35183635-35183657 CATCCAGTGTGGTCTGTGGGTGG - Intronic
1147207059 17:38845008-38845030 CAGCTACTCTGGGCTGAGGCAGG - Intergenic
1148238509 17:45984598-45984620 CACCCACTCTGCCTTGTGGCAGG + Intronic
1148341393 17:46875528-46875550 CATCTACTCTGGGCTGTGACTGG + Intronic
1148772288 17:50074384-50074406 CCCCAACTCTGGCCTGGGGCAGG + Intronic
1149398720 17:56271749-56271771 GAGCCACTCTGGTCTCTTGCAGG - Intronic
1150307255 17:64096115-64096137 GACCCATACTGGTCTGTGGATGG + Intronic
1150643604 17:66965094-66965116 CACCCACTCTGGTCTGTGGCGGG + Exonic
1150832985 17:68540594-68540616 CGCCCACTCAGGCCCGTGGCAGG + Intronic
1151871760 17:76841495-76841517 CACCCACCCATGTCTGTGGAGGG + Intergenic
1154122569 18:11663765-11663787 CACCCACTCTGCTCTGTGCCTGG - Intergenic
1154467902 18:14667769-14667791 CACCCACTCTTTTCTGTGTAGGG + Intergenic
1156781712 18:40858104-40858126 CAGCCACTCGGGGCTGAGGCAGG + Intergenic
1158800733 18:60905571-60905593 CTCCCACTCTCATCTTTGGCTGG - Intergenic
1158812042 18:61049273-61049295 CTCCCACTATGCTCTGTGGAAGG - Intergenic
1159437808 18:68441225-68441247 CACCTAGACTGGTCTGTGGCAGG + Intergenic
1161700369 19:5791154-5791176 CATCCGCTCTGGAGTGTGGCGGG + Exonic
1161960609 19:7520891-7520913 TACCCACTCTGGACTCTCGCCGG - Exonic
1163600972 19:18248726-18248748 GACCCTCTCTGGTCATTGGCTGG + Intronic
1163730033 19:18943637-18943659 CACCCTCTCCGGTCTCTGGGAGG + Intergenic
1164789582 19:30964734-30964756 CACCTACTCTGGTTTGTGCTTGG - Intergenic
1164914859 19:32044345-32044367 TGCCCACTCTTGTCTGTGCCTGG - Intergenic
1165079389 19:33298817-33298839 CCCCCACTCTGTCCTGTGTCTGG - Intergenic
1166820229 19:45574721-45574743 CACCCACTGTGGTCTGTGCCTGG + Intronic
1167561172 19:50226881-50226903 CACCCACTTTGGTCTCTCCCAGG + Exonic
1168103557 19:54153597-54153619 GCCCAACTGTGGTCTGTGGCGGG + Intronic
928439392 2:31279259-31279281 CACCAGCTCTGGTGTGTGACCGG - Intergenic
929646986 2:43637559-43637581 GGCCGACTCTGGGCTGTGGCGGG - Intronic
930034746 2:47078447-47078469 CACCCATTCTGGGCAGAGGCAGG + Intronic
930451801 2:51550313-51550335 CACACACTGGGGTCTGTGGTAGG - Intergenic
931051511 2:58420200-58420222 CCCAGACTCTTGTCTGTGGCAGG + Intergenic
932741166 2:74292115-74292137 CCCCCTCACTGGACTGTGGCAGG + Intronic
932832927 2:75008219-75008241 CACCCACTCTGGCCTTAGACAGG - Intergenic
933436061 2:82251358-82251380 CACACACTATGGCCTGTGGAGGG - Intergenic
934524115 2:95040827-95040849 CACAGCCTCTGTTCTGTGGCTGG + Intronic
934975827 2:98801475-98801497 GAGCCACTCTGCTCTGTGGCAGG + Intronic
935117112 2:100146188-100146210 CAACCTCTCTGGGCTGTGTCTGG + Intergenic
936155301 2:110043008-110043030 CACCCACTCTGGTGTGTGTTGGG - Intergenic
936189379 2:110328405-110328427 CACCCACTCTGGTGTGTGTTGGG + Intergenic
938097138 2:128471386-128471408 CACTCACTGTGGTGTGTGGGAGG + Intergenic
938097216 2:128471680-128471702 CACTCACTGTGGTGTGTGGGAGG + Intergenic
938669836 2:133576118-133576140 CACCCATTCAAGTCTGTAGCTGG - Intergenic
940985691 2:160049940-160049962 CACACACTGAGGCCTGTGGCAGG + Intronic
941134016 2:161690770-161690792 CACACACTGGGGCCTGTGGCAGG + Intronic
942632230 2:177963303-177963325 CACACACTCAGGTCTGTTTCTGG - Intronic
943439104 2:187903885-187903907 CACACACTCGGGCCTGTGGGAGG + Intergenic
948763064 2:240204526-240204548 CTCGGACTCTGGTCTGGGGCCGG + Intergenic
948866125 2:240775728-240775750 CACCCTTTCTGGGCTGAGGCTGG - Intronic
1169448569 20:5692150-5692172 CACCTGCTCTGGTCTCTGCCTGG - Intergenic
1170048384 20:12112326-12112348 CACATGCTCTGTTCTGTGGCAGG - Intergenic
1170511651 20:17083766-17083788 CTCACAATCTGGTCTCTGGCTGG + Intergenic
1171245834 20:23608796-23608818 CACTCACTCTGCTCTGAGTCCGG - Intergenic
1171418278 20:24998580-24998602 CACCCACCCTGCTCTCTGGAGGG - Intergenic
1172322020 20:34002772-34002794 CACCCACACAGTTCTCTGGCTGG + Intronic
1173155109 20:40602030-40602052 CTCTCACCCTGGTCTGTGTCTGG - Intergenic
1173252878 20:41373977-41373999 CACATACTCTGGTCAGTGTCCGG - Intergenic
1173567666 20:44053153-44053175 GACCCACTGAGGTCTGTGGTGGG + Intronic
1173858408 20:46266238-46266260 CACCTACTCTGGGCTGGGGTGGG + Intronic
1175014023 20:55768937-55768959 CTCCCACTCTGGATTGTGCCCGG - Intergenic
1175507560 20:59496531-59496553 CACCCACTCCGTGCTGGGGCTGG + Intergenic
1176062755 20:63179403-63179425 CACCCACTCGGGTTTGCTGCAGG + Intergenic
1176806610 21:13489884-13489906 CACCCACTCTTTTCTGTGTAGGG - Intergenic
1177071253 21:16511476-16511498 CACACACTGTGGCCTGTTGCAGG - Intergenic
1177801852 21:25835751-25835773 CTCCCACTCTGCTCTGAAGCAGG + Intergenic
1178523272 21:33303782-33303804 CCCCCGCTCTGGCCTTTGGCAGG + Intergenic
1178877996 21:36427473-36427495 CACCCACTCTGATACCTGGCTGG + Intergenic
1180019307 21:45111200-45111222 CACCCACAGAGGTCAGTGGCAGG - Intronic
1180069137 21:45427454-45427476 CACACAGTCTGGTCAGTGCCAGG - Intronic
1180996513 22:19968461-19968483 CACCCATCCTGGTTTGGGGCAGG + Intronic
1183184771 22:36285619-36285641 CTCCCACTCTGGGCTCTGGCTGG - Intronic
1185165313 22:49258304-49258326 CTCCCACTGGGGGCTGTGGCCGG - Intergenic
1185411310 22:50684400-50684422 CACACACTCTTGTCTGTAACTGG - Intergenic
950361213 3:12450647-12450669 CTCCCCCTCTGGTTTCTGGCTGG - Intergenic
950521966 3:13502606-13502628 CACCCTCTCAAGTCTGTGGTGGG - Intronic
950931089 3:16789504-16789526 CTCCCACACTCGACTGTGGCAGG + Intergenic
952258262 3:31714141-31714163 CCCTCACGCTGGACTGTGGCAGG - Intronic
953224028 3:40999923-40999945 AGCCCAGTCTGGTCTGTGTCTGG - Intergenic
954222381 3:49162647-49162669 CACCCACTCTGGTTTCTGAAAGG + Exonic
954608913 3:51934020-51934042 CACCCAGTATGGCCTGAGGCTGG + Intronic
954981981 3:54754593-54754615 CACCCACTCTGGTACGAGGCTGG - Intronic
955119198 3:56038914-56038936 CACCCACTGGGGCCTGTGGTAGG + Intronic
955496126 3:59534645-59534667 AACCCACTCAGGTCAGTGTCTGG - Intergenic
956457693 3:69439697-69439719 CAGGCACTCTGAGCTGTGGCAGG - Intronic
961630486 3:128295007-128295029 GTCCCATGCTGGTCTGTGGCTGG - Intronic
961832621 3:129632032-129632054 CTGCCTCTATGGTCTGTGGCTGG + Intergenic
963037816 3:141047812-141047834 CACCTACAATGGCCTGTGGCAGG + Intergenic
963719209 3:148840664-148840686 CACCCACTTTGGTTCGTTGCAGG + Exonic
963814257 3:149812645-149812667 CACCCACTCTGATCTCAGACTGG + Intronic
964944988 3:162210560-162210582 CAGCCACTTTAGTATGTGGCTGG + Intergenic
966315195 3:178636864-178636886 CACACACTGTGGTCTGTTGGGGG - Intronic
969231579 4:5835501-5835523 CTCCCACTCGGTTTTGTGGCTGG - Intronic
979349746 4:119629317-119629339 CACCCGCAGTGGTCCGTGGCTGG - Intergenic
979620959 4:122798198-122798220 CACGCCCTCTTGACTGTGGCAGG - Intergenic
985334021 4:188872265-188872287 CAGCTACTCGGGTCTGAGGCAGG + Intergenic
985487958 5:162565-162587 CACCCAGTGGGGGCTGTGGCCGG - Intronic
985521974 5:377972-377994 CACCCACTCTGTTCTGGGGGAGG + Intronic
985967081 5:3345658-3345680 CACCCACACTGGTCTCTGGAGGG + Intergenic
986125838 5:4881797-4881819 AACTCCCTCTGGTGTGTGGCAGG - Intergenic
987471235 5:18331140-18331162 CACACACTGGGGTCTGTGGAGGG - Intergenic
988786734 5:34572041-34572063 CACCATTTCTTGTCTGTGGCGGG - Intergenic
988868890 5:35366439-35366461 CTCCCTCTGTGGTCTGTAGCTGG - Intergenic
991434427 5:66582602-66582624 CACCCACTCTGAGCTGTGTGAGG + Intergenic
993296290 5:86145673-86145695 CACACACTGTGGTCTGTCGGGGG + Intergenic
1001428528 5:171641440-171641462 CACCCACCCTAGTCCATGGCAGG - Intergenic
1001826576 5:174750409-174750431 CATCCACTCTGGGCTGTTGAGGG - Intergenic
1006421353 6:33936006-33936028 CACCCAGGGTGGTATGTGGCTGG - Intergenic
1007400431 6:41599679-41599701 CACCCACAGAGGTCTGTGCCAGG + Exonic
1009751142 6:67880765-67880787 CACCCTCTGTGGACTGTGGTGGG + Intergenic
1011625312 6:89278775-89278797 CACCCACACTAGTGTGGGGCGGG + Intronic
1014558771 6:122864926-122864948 CACACACTGGGGTCTGTGGAGGG - Intergenic
1015213310 6:130721786-130721808 CACCCACTGTGCTGTGTGGCAGG + Intergenic
1015472403 6:133620567-133620589 CACACACTGGGGTCTGTGGGGGG + Intergenic
1018769419 6:166957793-166957815 CATCCACTGTGCTCAGTGGCAGG - Intergenic
1019142582 6:169957565-169957587 CAGGCACTGTGGTCAGTGGCTGG + Intergenic
1019219549 6:170463233-170463255 CACACACTCTGGTGTGGGGATGG + Intergenic
1019321595 7:418142-418164 CAGGCACCCTGGTGTGTGGCTGG - Intergenic
1019517100 7:1444931-1444953 CCCCCACCCTGGGGTGTGGCCGG + Exonic
1019593218 7:1846142-1846164 TCCCCACTGTGGTCTGGGGCCGG - Intronic
1019700962 7:2474925-2474947 CTCCCACCCTGGTCTGTGCATGG - Intronic
1019709809 7:2513050-2513072 AACCCACTGTGGGCTGGGGCTGG - Intronic
1019922465 7:4171778-4171800 CCCCATCTCTGGTCTGTGGTGGG + Intronic
1020007406 7:4789948-4789970 CACCCGCCCAGGGCTGTGGCAGG - Intronic
1020910824 7:14128205-14128227 CACACACTATGGTCTGTCGGGGG - Intergenic
1022089169 7:27096539-27096561 CACCTCCTCTGTTCTGAGGCTGG + Intergenic
1024286540 7:47762837-47762859 CACTCCCTCTGGTTTGTGGGGGG + Intronic
1025654666 7:63508985-63509007 CACCCAGGCTGGAGTGTGGCGGG + Intergenic
1026339232 7:69421150-69421172 CCCCCACTTTGGGCTGAGGCGGG - Intergenic
1026557510 7:71421095-71421117 CTCCCCATCAGGTCTGTGGCTGG + Exonic
1027133068 7:75605213-75605235 CACCCGCTCTGTACTGTGGAGGG + Intronic
1028539957 7:91931941-91931963 CACACACTGGGGCCTGTGGCAGG + Intergenic
1031088360 7:117324475-117324497 CCCCCACGCTGGTCCCTGGCAGG + Intergenic
1032419166 7:131764241-131764263 CACCCACTGTGCTCCCTGGCTGG - Intergenic
1032606882 7:133365037-133365059 CTCACACTGTGGTCAGTGGCAGG + Intronic
1034674774 7:152884513-152884535 CACACACTCTGCTCTGTCACAGG - Intergenic
1034690795 7:153012120-153012142 CACACACTGGGGTCTGTTGCGGG + Intergenic
1035109030 7:156464861-156464883 TACCCACTGTGGTGTGTGCCAGG - Intergenic
1036097353 8:5738754-5738776 CACACACTGGGGCCTGTGGCGGG - Intergenic
1036395086 8:8362571-8362593 CACCCATTCTCCTCTGGGGCAGG - Intronic
1039506095 8:38053462-38053484 CAGCTACTCTGGACTGAGGCAGG - Intronic
1042818397 8:72903388-72903410 CTCCAACTCTTGTCTGTCGCTGG + Intronic
1048031958 8:130641366-130641388 CACCCACTTTGGGCTGAGGTTGG - Intergenic
1049719120 8:144107487-144107509 CACCGGCTCTGGTCTTGGGCCGG + Exonic
1052414434 9:28158677-28158699 AACCCCCTCTTGTCTGTGCCAGG - Intronic
1054864493 9:69986195-69986217 CACACACTCTGGAGTCTGGCAGG + Intergenic
1056511875 9:87314200-87314222 CACTCAGCCTGGTCTTTGGCTGG - Intergenic
1056554096 9:87675129-87675151 TACACACTCTTGTCTGTGCCTGG + Intronic
1057494070 9:95546200-95546222 CATCCTTTCTGGTCTGTGGGAGG - Intergenic
1058085375 9:100742639-100742661 CACCCACTGTGGCCTGTCGTGGG - Intergenic
1059456768 9:114404650-114404672 CACACACTCTGGAGTCTGGCAGG + Intronic
1059561607 9:115340253-115340275 CACCGACTCTGCTATGTGCCAGG + Intronic
1060152132 9:121295583-121295605 CACCTCCTCTGGTCTCTGGTAGG + Intronic
1061305387 9:129729736-129729758 CATCCAGTCTGCTCTGTGGCAGG - Intergenic
1061431095 9:130531815-130531837 CCTGCTCTCTGGTCTGTGGCTGG - Intergenic
1062357908 9:136173727-136173749 CACACACCCGGGTCTGTGTCAGG - Intergenic
1062420092 9:136476549-136476571 CACCCACTGGGGGCTGGGGCCGG - Exonic
1185934198 X:4237210-4237232 CACCCACTCTGCTCCTTGGAGGG - Intergenic
1188432207 X:30116989-30117011 TAGCCATTCTGGTGTGTGGCTGG + Intergenic
1189096747 X:38148682-38148704 CACCAAGTCTGGTGTGTGGAGGG - Intronic
1189530341 X:41874336-41874358 CACACACTCGGGCCTGTAGCAGG - Intronic
1190550168 X:51571533-51571555 CACCCACTCTCCACTGTGTCAGG + Intergenic
1193900949 X:87176575-87176597 CACACACTGGGGTCTGTGGGAGG - Intergenic
1194766012 X:97845866-97845888 CACGCATTCTGTTCTCTGGCAGG + Intergenic
1195813495 X:108859594-108859616 CACCCACTGGGGCCTGTGGTGGG + Intergenic
1196758777 X:119181233-119181255 CACCCACTGGGGTCTGTTGTGGG + Intergenic
1197630506 X:128852678-128852700 CACCTTCTGTGTTCTGTGGCTGG - Intergenic
1198958889 X:142162578-142162600 CACACACTAGGGTCTTTGGCGGG + Intergenic
1198995200 X:142566637-142566659 CTCCCCCTCTGGCCTATGGCAGG + Intergenic
1200405081 Y:2801916-2801938 CACACACTGGGGTCTGTGGTGGG - Intergenic