ID: 1150647163

View in Genome Browser
Species Human (GRCh38)
Location 17:66986148-66986170
Sequence TTCTGGCCTCCTCTCATAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 150}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150647163_1150647171 -3 Left 1150647163 17:66986148-66986170 CCTCTTATGAGAGGAGGCCAGAA 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1150647171 17:66986168-66986190 GAAGCTGGGGACAGGGAGGTAGG 0: 1
1: 0
2: 14
3: 93
4: 988
1150647163_1150647172 14 Left 1150647163 17:66986148-66986170 CCTCTTATGAGAGGAGGCCAGAA 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1150647172 17:66986185-66986207 GGTAGGAGAACAGAAGCAAAAGG 0: 1
1: 0
2: 3
3: 48
4: 482
1150647163_1150647168 -10 Left 1150647163 17:66986148-66986170 CCTCTTATGAGAGGAGGCCAGAA 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1150647168 17:66986161-66986183 GAGGCCAGAAGCTGGGGACAGGG 0: 1
1: 0
2: 10
3: 71
4: 705
1150647163_1150647169 -7 Left 1150647163 17:66986148-66986170 CCTCTTATGAGAGGAGGCCAGAA 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1150647169 17:66986164-66986186 GCCAGAAGCTGGGGACAGGGAGG 0: 1
1: 0
2: 17
3: 129
4: 934
1150647163_1150647173 15 Left 1150647163 17:66986148-66986170 CCTCTTATGAGAGGAGGCCAGAA 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1150647173 17:66986186-66986208 GTAGGAGAACAGAAGCAAAAGGG 0: 1
1: 1
2: 4
3: 62
4: 573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150647163 Original CRISPR TTCTGGCCTCCTCTCATAAG AGG (reversed) Intronic
900144105 1:1150555-1150577 GTCTGGCCTCCTCCCAAATGGGG - Intergenic
900995414 1:6120948-6120970 TCCTGGCCTCCCCTCACCAGGGG + Intronic
903759907 1:25690608-25690630 GTCTGGCCACCTCTCAGCAGAGG - Intronic
905698597 1:39994703-39994725 GTATTTCCTCCTCTCATAAGTGG + Intergenic
905972731 1:42153823-42153845 TTCTGGCCTCCTCCCATGCAAGG - Intronic
907395567 1:54187382-54187404 TTCTGCCCACCTCCCCTAAGAGG + Intronic
908752755 1:67440446-67440468 TTCTTTCCTCCTCTCATAAATGG - Intergenic
912138673 1:106694578-106694600 TTCTGTCTTCCTCTCCTAAATGG + Intergenic
915979132 1:160409258-160409280 TTCTGGCCTCCTCTAATTGTTGG - Intronic
919023628 1:192140140-192140162 TTCTGCCTTCCTGTCTTAAGTGG - Intergenic
919234332 1:194819219-194819241 TTCTGTTATCCACTCATAAGAGG - Intergenic
919317941 1:195999157-195999179 TTCTGGACTCCACTCAAAACTGG - Intergenic
919565898 1:199187493-199187515 TTCTGGCCTACTCCCACAACGGG - Intergenic
920876769 1:209843714-209843736 TTCAAGCCTCCTCTCTGAAGGGG + Intronic
923433137 1:233942919-233942941 TTTTAGACTCCTCTTATAAGTGG + Intronic
1064506726 10:16039165-16039187 TTCTGGTTTTCTCTTATAAGGGG + Intergenic
1067275031 10:44826665-44826687 GTCTGGCCTCCTCCCCTGAGAGG + Intergenic
1069540088 10:69287531-69287553 TTCTGGCCATTTCGCATAAGTGG - Intronic
1071158211 10:82715929-82715951 CTCTAGCCTCTTCTTATAAGTGG + Intronic
1071937653 10:90549069-90549091 TTCTGGACTCCACTCAAAACTGG - Intergenic
1071989120 10:91082645-91082667 TGCTGGGCTCTTCTGATAAGGGG + Intergenic
1075505234 10:123015469-123015491 CCCTGGCCTCTACTCATAAGAGG + Intronic
1077635286 11:3837964-3837986 TTTTGTCCTCATCTCATATGGGG - Intronic
1078042946 11:7884862-7884884 TTCTGAGCTCCACTCAGAAGTGG + Intergenic
1080400726 11:31933232-31933254 TTTTTGCCTCCTCTCACCAGCGG - Intronic
1080692401 11:34569370-34569392 TTCTTGGCGCCTCTTATAAGTGG + Intergenic
1081609028 11:44547645-44547667 TTCTGGACTCCACTCAAAACTGG - Intergenic
1081668599 11:44930997-44931019 TTCTGGCTGCATCTCAGAAGGGG - Exonic
1086834080 11:91600160-91600182 TTCTGGACTCCACTCAAAACTGG - Intergenic
1088424590 11:109688717-109688739 TTCTTGCCTTCTCTAATAACAGG - Intergenic
1090945517 11:131426277-131426299 TTCTGTCCTCCTCACTCAAGGGG - Intronic
1091638659 12:2217179-2217201 TTCTGGGTACCTCACATAAGTGG - Intronic
1091977805 12:4839838-4839860 TGGTGGCCTCCTCTGATAAATGG - Intronic
1092447267 12:8568649-8568671 CTCTGGCCTCAACTCAGAAGGGG + Intergenic
1092516142 12:9215783-9215805 TTCTGAAGTCCTCTCATAATGGG - Intergenic
1092727034 12:11496973-11496995 TTCTAGGCACCTCACATAAGTGG + Intronic
1093645698 12:21583450-21583472 TTCTGGACTCCACTCAAAACTGG - Intronic
1093650719 12:21642225-21642247 TTCTGGCCACATCTCATTTGGGG - Intronic
1096753340 12:53777639-53777661 TTCTGGCCTCCTAACATACCAGG - Intergenic
1097506508 12:60479692-60479714 TACTGGTCTCTTCTTATAAGAGG + Intergenic
1099578057 12:84405237-84405259 TTCTGGACTCCACTCAAAACTGG - Intergenic
1103397168 12:120616949-120616971 TTCTGGACTCCTCATATAAATGG + Intergenic
1105817183 13:24047281-24047303 CTCTGGCCACATCTCCTAAGAGG + Intronic
1106209813 13:27631370-27631392 TTATGCCCTACTCTCAGAAGTGG + Intronic
1106311642 13:28559862-28559884 CTCTAGCTTCCTCACATAAGTGG + Intergenic
1107473826 13:40715722-40715744 TTCTAGGTTCCTCACATAAGTGG + Intergenic
1107753807 13:43597857-43597879 ATCTGGCCTCTTCTCATATCAGG + Intronic
1112412765 13:99178249-99178271 TTCTGGGCACCTCATATAAGTGG + Intergenic
1115059682 14:29173662-29173684 TTCTGGACCCCACTCATAATTGG - Intergenic
1115155466 14:30333959-30333981 CTCTGGGCTCCTCTTATTAGAGG + Intergenic
1121776598 14:96594904-96594926 TCCTGGCCTTCTCTCATCAATGG + Intergenic
1122066693 14:99178610-99178632 TTCTGGCCAGCTCTCCTATGAGG - Intronic
1124937094 15:34183797-34183819 TTTTGCCCTCTTCTCATAAATGG - Intronic
1125509298 15:40284027-40284049 TGCTCGCCTCCTCTCTTTAGGGG - Intronic
1125733918 15:41910406-41910428 TTCTGGGCTCCTCTCCCAGGGGG - Intronic
1128667054 15:69546266-69546288 TTCTGGGCACTTCTTATAAGTGG - Intergenic
1129379268 15:75155059-75155081 TTCTGGCTTCCTCTCCCAAAAGG - Intergenic
1130204990 15:81867574-81867596 TTCTGGCCACCTCTTAGAATGGG + Intergenic
1131222515 15:90596982-90597004 CTCTGGCCTCCTCTCAGAGTGGG + Intronic
1131424383 15:92333805-92333827 TTCTGGGCTCCTCTCTAATGAGG - Intergenic
1133537447 16:6715623-6715645 TTCTGGCCTCATCTCCTATCCGG + Intronic
1135516462 16:23139725-23139747 TTAAGGCTTCCTCTCTTAAGTGG + Intronic
1135735906 16:24931517-24931539 TCCTGACCACCTCTCATCAGAGG - Intronic
1137244471 16:46690824-46690846 TTCTGTCTTCCTCTCACCAGAGG + Intronic
1137386422 16:48047097-48047119 ATCTGGACTCCTCTTTTAAGTGG + Intergenic
1138868352 16:60850556-60850578 TTCTGGACTCCACTCAAAACCGG - Intergenic
1141572214 16:84941044-84941066 TCCTGGCCGCCTCTCAGGAGGGG - Intergenic
1144150720 17:12440677-12440699 TTATTGCCTCTTCTCATAACTGG - Intergenic
1144162760 17:12577989-12578011 TCCTGGCCTTCACTCATTAGGGG + Intergenic
1144679615 17:17184283-17184305 TTCTGGCATTCCCTCATCAGAGG - Intronic
1147967444 17:44200499-44200521 GTCTGGCCTCTTCACAGAAGTGG - Intergenic
1148284926 17:46380255-46380277 TTCTGACATCATCTTATAAGTGG + Intergenic
1148307147 17:46598176-46598198 TTCTGACATCATCTTATAAGTGG + Intronic
1149868944 17:60165971-60165993 TTCAGTCTTCCTCTTATAAGTGG - Intronic
1150647163 17:66986148-66986170 TTCTGGCCTCCTCTCATAAGAGG - Intronic
1150852346 17:68715379-68715401 TGCTTCCCTCCTCTCTTAAGGGG - Intergenic
1151344215 17:73491892-73491914 TCCTGGCCTCCTCTCAGATCTGG - Intronic
1153570287 18:6465168-6465190 TTCTAGACTCCTCATATAAGTGG + Intergenic
1154391804 18:13943479-13943501 TTCTGGGCACCTCATATAAGTGG - Intergenic
1165824327 19:38697186-38697208 TTCTGGCCACCTGTCCTCAGAGG - Intronic
1167466321 19:49652551-49652573 CTCCGGCCTCCTCACCTAAGCGG + Exonic
1168296380 19:55379054-55379076 CTCTGGCCCCCTCTGAGAAGGGG + Intergenic
928234684 2:29529333-29529355 GGCTGGCTTCCTCTCATAACAGG - Intronic
934547102 2:95226892-95226914 TTCTGGTCTCCTGGCTTAAGTGG + Intronic
935570683 2:104658062-104658084 TTTTTGCATCATCTCATAAGAGG + Intergenic
936820836 2:116518610-116518632 TTTTTGCCTCCTTTCATGAGTGG + Intergenic
937614526 2:123905806-123905828 TTCTGTCCTCCTGTAATTAGAGG - Intergenic
937785239 2:125887961-125887983 TTCTGGACTCCATTCACAAGTGG + Intergenic
940268422 2:151864891-151864913 TTATGTCCTACTCTCAAAAGTGG + Intronic
944701459 2:202249954-202249976 TTCCAGCCTCCTCACATAACTGG - Intergenic
946478160 2:220028882-220028904 TCATGGGCTCCTCTCAGAAGAGG - Intergenic
1168875299 20:1167575-1167597 TTCTGGACAGTTCTCATAAGTGG + Exonic
1169895353 20:10500006-10500028 TTCTGGTCTCCTGACAAAAGAGG - Intronic
1170605468 20:17872455-17872477 TTCTGTCGCCCTCTCATAAGTGG - Intergenic
1174362382 20:50037125-50037147 TTCTGGACTCATCTCAGACGGGG + Intergenic
1178012624 21:28304941-28304963 TTCTGGACTCCACTCAAAACTGG - Intergenic
1178919281 21:36728165-36728187 TTCCAGCCACCTCTCAGAAGTGG - Intronic
1179415185 21:41192755-41192777 TTCTGGACTCCACTCAAAATTGG + Intronic
1181753887 22:25009187-25009209 TTCTTGCCTCCTGGCTTAAGGGG + Intronic
1184559367 22:45253027-45253049 TTCTGTCCTCTTCTCATGATGGG + Intergenic
1185111329 22:48901754-48901776 TTCTGGCCTCCTCACAGCAGAGG - Intergenic
1185111581 22:48903014-48903036 TTCTGGCCTCCTCACAGCAGAGG + Intergenic
950954251 3:17034326-17034348 CTCTGGCCACCTTTGATAAGTGG + Intronic
952649997 3:35714355-35714377 TTCTGCCTGCCTCTCAGAAGTGG + Intronic
955210874 3:56939795-56939817 ATCTGTCCTCCTATCATAAAAGG - Intronic
957775859 3:84756796-84756818 TTCTGGTCTCCTCTCCGATGAGG - Intergenic
959590925 3:108079917-108079939 ATTTGGCCTCCTCTCGAAAGAGG + Intronic
960903472 3:122574779-122574801 TTCTGGGCTTCTCTCAGAAATGG + Exonic
964721269 3:159769159-159769181 TTGTGGCCCGCTCTCATAAGAGG - Intronic
965708330 3:171531972-171531994 TTCTGGCCGTGTGTCATAAGGGG + Intergenic
966817069 3:183897985-183898007 TTCTGGCCTCCTTGCAAAGGAGG + Intergenic
966927285 3:184653044-184653066 TCCTCTCCTTCTCTCATAAGAGG - Intronic
967130505 3:186466068-186466090 TTCTGGTCTCCATTCAGAAGTGG + Intergenic
967878315 3:194281644-194281666 TTTTGGCCTCCGCTCACAAGGGG + Intergenic
970534676 4:17018516-17018538 TTCTGTCATCATCACATAAGGGG + Intergenic
971979329 4:33733106-33733128 TTCTGGACTCCACTCAAAACTGG + Intergenic
973947582 4:55974977-55974999 TTCTGGCCTACTCTTATAAAGGG - Intronic
975599577 4:76085374-76085396 TTCTGCCATCCAATCATAAGTGG - Intronic
975610881 4:76201683-76201705 TTTTGGCCTCCTTTCATAAATGG + Intronic
980567415 4:134562064-134562086 TTCTGGACTTCTTTCAAAAGAGG + Intergenic
984757194 4:183336124-183336146 TTCTAGCCTCATTCCATAAGGGG + Intergenic
985538426 5:476884-476906 TCCTGGCCTCCTGTCTGAAGTGG + Intronic
985876077 5:2596956-2596978 TTCTGGGCTCCTCTTCTAATTGG - Intergenic
986077321 5:4351378-4351400 ATCTGGATTCTTCTCATAAGAGG + Intergenic
986662595 5:10072731-10072753 TTCTGGCTCCCTCTCCTCAGTGG + Intergenic
987153139 5:15061431-15061453 TTCTGGACTCCACTCAAAACTGG - Intergenic
987246189 5:16051377-16051399 TTGTGGCCTTGACTCATAAGTGG - Intergenic
988807587 5:34754673-34754695 TTCTGGCCTGCACTGAAAAGAGG + Intronic
991437476 5:66611437-66611459 TTCTGTCCTCCTCTCATGAGAGG + Intronic
993824506 5:92665860-92665882 TTCTGGCCTCCTTGCTTAGGAGG - Intergenic
996741111 5:126799851-126799873 TTATAGTCTCTTCTCATAAGAGG - Intronic
1001395690 5:171418756-171418778 TTCCGGCCTCCTCCCAAAACCGG - Intergenic
1003150496 6:3544034-3544056 ATGTGGCCTCCTTTCATAAGTGG - Intergenic
1007269430 6:40624853-40624875 CTCTGGCCACCTCTCAGAGGTGG - Intergenic
1011551154 6:88532109-88532131 TTCTGGGCTCCACTACTAAGAGG + Intergenic
1012226693 6:96712122-96712144 ATCTGGCTACCTTTCATAAGGGG + Intergenic
1012465281 6:99510581-99510603 TTCTAGCCTCTTATTATAAGAGG - Intronic
1013292685 6:108732614-108732636 ATCCGGCCTCCTCTCATTAGTGG + Intergenic
1014688178 6:124529988-124530010 CTCTGGCCTCTTCTTATGAGAGG - Intronic
1016739596 6:147513314-147513336 TGCTGTCCTACTGTCATAAGTGG - Intronic
1018599849 6:165527293-165527315 TTCTGGACTCCACTCAGAACTGG - Intronic
1024835448 7:53512971-53512993 TCCTCTCCTCTTCTCATAAGGGG - Intergenic
1028141703 7:87281750-87281772 TTCTGGACTCCACTCAAAACCGG - Intergenic
1030800538 7:113844881-113844903 CTCTGGTCTCTTCTTATAAGAGG - Intergenic
1035256871 7:157634902-157634924 TTCTGGGCTCCTCCCACACGCGG - Intronic
1035320666 7:158027268-158027290 TCCTGGCTTCCACTCAGAAGTGG + Intronic
1038517143 8:28196974-28196996 TTCTGGCTTCCTCTCCTGCGTGG - Intergenic
1040877169 8:52166057-52166079 TCCTGGCCTCCTCTCGCAATGGG - Intronic
1041440172 8:57886267-57886289 CTCTGGCCTAGTCTCAGAAGGGG + Intergenic
1041720690 8:60972672-60972694 TTGTGGCCCCCACCCATAAGTGG + Intergenic
1042868335 8:73375548-73375570 TTCTGGGTACCTCACATAAGTGG - Intergenic
1043155514 8:76773971-76773993 TTCTGTCCTCCTTTCCAAAGTGG + Intronic
1058931973 9:109729596-109729618 TTCTGGCCTCCTCTACCAAGGGG - Intronic
1059036769 9:110762046-110762068 ATCTGGCCTCCTAGCAGAAGCGG + Intronic
1061569239 9:131466245-131466267 TTCTGCCCTCCTTTCATTAAAGG + Intronic
1061583505 9:131552260-131552282 TTGTGGCCTCCTCACAGGAGGGG - Intergenic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1186912123 X:14179305-14179327 GTCAGGACTCCTCACATAAGAGG - Intergenic
1193904452 X:87225594-87225616 TTCTGGACTCCACTCAAAACTGG - Intergenic
1193914836 X:87352165-87352187 TTCTGGACTCCACTCAAAACTGG + Intergenic
1194057380 X:89152037-89152059 TTCTTGCCTCCTCACATACCAGG + Intergenic
1195676263 X:107509334-107509356 TTCCTGCCTCCTCTCATGAGAGG + Intergenic
1196136403 X:112214230-112214252 TTTTGGATTCCTCTTATAAGTGG + Intergenic
1200166897 X:154042241-154042263 TTCTCGCATCTTCTCAAAAGTGG - Intronic