ID: 1150650471

View in Genome Browser
Species Human (GRCh38)
Location 17:67006589-67006611
Sequence CAAGTGCTGAATGGGGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150650471 Original CRISPR CAAGTGCTGAATGGGGTGTC TGG (reversed) Intronic
902148267 1:14421285-14421307 CAAATTCTGAATGGGGTGCTAGG - Intergenic
903874693 1:26465638-26465660 CAAGTGCTGAGTGCAGTGGCTGG + Intronic
905205361 1:36340220-36340242 CAAGTGCTGGATGGGGCATGGGG + Exonic
906085210 1:43127125-43127147 ATAGTGATGAATGAGGTGTCTGG + Intergenic
906671633 1:47659406-47659428 CAAGTGCTGAATGGGCAGCTTGG - Intergenic
907161745 1:52376007-52376029 CACGTGCTGTAAGGGGTGCCTGG - Intronic
909611275 1:77554164-77554186 CAAATGCTGCATGGGGTGATGGG - Intronic
911524877 1:98972758-98972780 CAAGTGATGAATGATTTGTCAGG + Intronic
912254349 1:108044107-108044129 CCAGGGCTGAATGGGGTCTGTGG - Intergenic
915264063 1:154702514-154702536 CCAGTGCAGAATGGAGAGTCTGG + Exonic
915527694 1:156486210-156486232 CAGGTGAGGAATGGGGTGTCTGG - Intronic
917225429 1:172776584-172776606 AAAGTGCTGAATGTGGGGGCGGG - Intergenic
917959710 1:180132500-180132522 CAAGTGCTGCATGGACAGTCAGG + Intergenic
920998073 1:211014263-211014285 CAAGTGCTGAGTGGATTGTTGGG - Intronic
921906241 1:220498212-220498234 CAAGTGGGGAATGGGGTGGGTGG + Intergenic
1063120254 10:3100918-3100940 CAGGTGCTGTAAGGGGTGACTGG + Intronic
1063542862 10:6951876-6951898 CAAGTGCTCATTAGAGTGTCTGG - Intergenic
1063874962 10:10465592-10465614 GAAGCGCTGAATGGGGTGTCAGG + Intergenic
1065063462 10:21932918-21932940 CCAGTGCTGAATGGGGTAAGGGG + Intronic
1066396461 10:35028435-35028457 CAAGGGCTGAATGAGGTATTTGG + Intronic
1067928250 10:50532926-50532948 CAAGTGCTGAGTTAGGTGCCAGG + Intronic
1069457024 10:68561189-68561211 CAAGTTGTGAGTGGGGAGTCCGG + Intronic
1070701536 10:78604942-78604964 CAAGGGCAGGATGTGGTGTCAGG + Intergenic
1071293657 10:84204221-84204243 CAAGGGCTGAGTGTGGTGTGTGG + Intronic
1075477925 10:122752713-122752735 CTAGTGTTGAATGAGGTGGCAGG + Intergenic
1075648544 10:124112345-124112367 CAAGAGCTGGATAGGATGTCAGG + Intergenic
1076704149 10:132292085-132292107 CCAGTGCTGACTGGGGTCTGAGG - Intronic
1079107139 11:17578824-17578846 GAAGCACTGAGTGGGGTGTCTGG + Intronic
1085263285 11:75220910-75220932 TAAGTGCTGAATGTGTTGCCAGG + Intergenic
1087566360 11:99864073-99864095 CAAGTGCTTTATATGGTGTCTGG + Intronic
1088798616 11:113285888-113285910 CAGGTGCTGTATGTGGTGCCGGG - Intergenic
1092506986 12:9112555-9112577 CGGGTGCTGAATGGGGTTTCAGG - Intronic
1093834008 12:23803482-23803504 CAAGAGCTAAATGGGGTTTTTGG - Intronic
1093881215 12:24406262-24406284 CAGGTGCTGAGTGGGGAGTAGGG + Intergenic
1097807557 12:63982474-63982496 CAGGTTCTGAATGGGGAGTCAGG - Intronic
1101557495 12:105824033-105824055 CTGGTGGTGAATGGGGTGTAAGG - Intergenic
1102652633 12:114453064-114453086 CAAAAGCTGAATGTGGTGACAGG - Intergenic
1104970839 12:132529919-132529941 CCTGTGCTGCATGGGGTCTCAGG + Intronic
1105387871 13:19948772-19948794 CAGGTGTGGAATGGGGTGTGTGG + Intergenic
1106940677 13:34775488-34775510 CCAGTGCATGATGGGGTGTCAGG + Intergenic
1107257431 13:38445278-38445300 CAATTTCAGAATGTGGTGTCAGG - Intergenic
1113627370 13:111856906-111856928 CCAGTGCTGCCTGGGGAGTCAGG + Intergenic
1115152322 14:30300204-30300226 CAAGCTCTGAATGGGAGGTCAGG - Intergenic
1116784454 14:49271650-49271672 AGAGTGCTCAATGGGCTGTCTGG + Intergenic
1116926229 14:50640687-50640709 GAAGGGCTGAATGGAGTCTCTGG - Intronic
1117457088 14:55909009-55909031 AAAGTGCTGAAAGGACTGTCAGG - Intergenic
1124944697 15:34253515-34253537 GAAATACTGAATGGGGAGTCAGG + Intronic
1128707351 15:69846584-69846606 AAAGTGCTGAATGCAGTGCCTGG + Intergenic
1128760290 15:70212224-70212246 CACGTGCTGAATGTGGGGACTGG - Intergenic
1130127631 15:81107115-81107137 CATCTGCTGAATGAGGTGCCTGG + Intronic
1130677050 15:85962233-85962255 TAAGTGCTGCATGTGGAGTCTGG + Intergenic
1131818138 15:96244159-96244181 CCAGTCCTGAAGGGGGTATCTGG + Intergenic
1132689836 16:1177532-1177554 CAAGTGAGAAATGGGGTGTTGGG + Intronic
1133725729 16:8535793-8535815 CATGTGCTGCCTGGGGTGTGTGG + Intergenic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1140116055 16:72042506-72042528 CAAGTGATTAATGGGGTGGCAGG - Intergenic
1141688546 16:85583814-85583836 CAATTGCTGGAGGGGCTGTCTGG + Intergenic
1142672757 17:1494814-1494836 CAAGTGCTGGATGTGGGGACAGG + Exonic
1143336743 17:6177111-6177133 CCAGTTGTGAAAGGGGTGTCTGG + Intergenic
1143986668 17:10920585-10920607 CATGTGCTGTGTGGGGTGCCTGG - Intergenic
1144745674 17:17612566-17612588 CAGGTACTGAATGGAGTGCCTGG + Intergenic
1144774407 17:17777841-17777863 CAAATGCTGAATGGAGAGTCCGG + Intronic
1148338280 17:46856292-46856314 AAAGGGCTGGATAGGGTGTCTGG + Intronic
1150650471 17:67006589-67006611 CAAGTGCTGAATGGGGTGTCTGG - Intronic
1155361298 18:25005767-25005789 CATGAGCTGCATGGCGTGTCTGG - Intergenic
1155520689 18:26665554-26665576 AAATTGCTAAATGGTGTGTCTGG + Intergenic
1156097272 18:33550617-33550639 CAAGAGCTGAACGGGGACTCAGG - Intergenic
1157450865 18:47787762-47787784 AAAGTACTGAACGGAGTGTCTGG - Intergenic
1165104056 19:33458385-33458407 CAAGTGATGTATGGTGTGTGTGG + Intronic
1166856707 19:45785934-45785956 CCAATGCTGAATGGTGTGCCAGG + Exonic
928982950 2:37155391-37155413 CAAGTCCTGGATGGGGTATCTGG - Intronic
937072346 2:119073688-119073710 CAAGTTCTGACTGAGGAGTCTGG + Intergenic
942333057 2:174849699-174849721 AAAGTGCTTAGTTGGGTGTCTGG - Intronic
1169967366 20:11232656-11232678 CAACTGCTGGATGTGGTGTGGGG + Intergenic
1171358778 20:24571983-24572005 CAAGTGATGAATGAGGGGTCTGG - Intronic
1173818993 20:46008820-46008842 CAAGTGCTGACTCAGGGGTCAGG - Intergenic
1175650233 20:60715430-60715452 CTAGTGCTCTTTGGGGTGTCAGG + Intergenic
1175983842 20:62754593-62754615 GCCGTGCTGATTGGGGTGTCAGG - Intronic
1177730127 21:25018074-25018096 TAAGTGATGATTGGGATGTCTGG + Intergenic
1179107484 21:38415869-38415891 CAAGTGCTGGCTGTGTTGTCTGG + Intronic
1179412083 21:41169300-41169322 CAGGGGCTGAGTGAGGTGTCCGG + Intronic
1179463823 21:41557417-41557439 CAAGTTCTGAAAGGGGAGTTGGG + Intergenic
1182410768 22:30183503-30183525 TAGGTGCTTAATGGAGTGTCTGG - Intergenic
1182558186 22:31140342-31140364 CCAGTGCAGAATGGGGGTTCAGG - Exonic
1183084359 22:35477479-35477501 CAAGTGCTCCATGGGATGCCTGG - Intergenic
1184745427 22:46453029-46453051 CAAGTGCTCAGTGGGGCGCCAGG - Intronic
949177429 3:1082081-1082103 CCAGTGGTGAATGGTTTGTCTGG + Intergenic
952735940 3:36691689-36691711 TGAGTGCTGAATGGGGTATTAGG - Intergenic
953231460 3:41068808-41068830 CAAGTGTGGAAGGGGGAGTCCGG + Intergenic
954093941 3:48307833-48307855 CAAGTACAGAATGTGATGTCTGG - Intronic
956618873 3:71200180-71200202 CAAGTGCTGAATCGGCTCTCTGG - Intronic
961465652 3:127079454-127079476 CAGGTGCTGAGAGGGGTTTCTGG + Intergenic
962530654 3:136277097-136277119 CTAGTGCTGATGGGAGTGTCAGG + Intronic
965696084 3:171409700-171409722 CATGTGATGTATGTGGTGTCTGG - Intronic
966276137 3:178172394-178172416 CAAGAGCTGAAAGGGGTATAAGG + Intergenic
969183723 4:5460577-5460599 CAAGTGCTGACTGCCCTGTCGGG - Intronic
972148871 4:36064472-36064494 CAGGTAGTGAATGGGGTGGCAGG + Intronic
972236042 4:37135326-37135348 CAAGGGGTGAATGAGCTGTCTGG - Intergenic
974663732 4:64930413-64930435 CAAGTTCTGATTGGAGTCTCTGG - Intergenic
976105228 4:81610105-81610127 CAAGTGCTGACAGGGCTGTGGGG + Intronic
981815783 4:148829496-148829518 CATGTGCTGCAAGGGGGGTCAGG - Intergenic
982128852 4:152208719-152208741 CAAGTGCTGAAAGGGATGTGGGG - Intergenic
986604413 5:9507629-9507651 CAAGTGCTGAATGGTGACCCAGG + Intronic
988288499 5:29253442-29253464 CAAGTGTTGAAGGTGGAGTCTGG - Intergenic
990411308 5:55543792-55543814 GAAGTGGGGAATGGGGTGGCCGG + Intergenic
992744613 5:79806832-79806854 AAAGTGCTGAAAGGGCTGTATGG + Intergenic
1003305604 6:4924570-4924592 CAAGAGCTCAATGGGGAGTGAGG - Intronic
1006130374 6:31865539-31865561 CAAGTGCTGCCTCTGGTGTCTGG - Exonic
1006618360 6:35344865-35344887 CAAGTGCTGCAAAGGGGGTCTGG - Intronic
1012058464 6:94446264-94446286 AAAATGCTGAATGGGGAGCCTGG + Intergenic
1013525681 6:110971670-110971692 CAAGTGCTGACTGGTGCTTCTGG + Intergenic
1013573025 6:111448923-111448945 AAAGTGCTGAATGGGATTACAGG + Intronic
1013686915 6:112595777-112595799 CAAGTGCTTAGTGGATTGTCTGG - Intergenic
1015000211 6:128205170-128205192 TAAGTGCGGAATGTGGTGTTTGG - Intronic
1015470045 6:133594507-133594529 CAAGTGCTGAAAGAGTTATCGGG - Intergenic
1015816857 6:137219598-137219620 GAATTGCAGAATGGGGTGCCAGG - Intergenic
1017451650 6:154559750-154559772 AAAGTGCTGAAGGGTGAGTCTGG + Intergenic
1024060981 7:45698566-45698588 GAAGTGCTGAGTTGGGTGCCCGG + Intronic
1024235307 7:47393327-47393349 CACGTGCTGTCTGGCGTGTCTGG - Intronic
1031778684 7:125935138-125935160 GAAGTTCTGAATTGGGTCTCAGG + Intergenic
1034298854 7:149997479-149997501 CAAGTGCTTAAGAGAGTGTCTGG + Intergenic
1034556559 7:151854074-151854096 CAAGGGCTGGCTGGGGTGACAGG - Intronic
1034807163 7:154099302-154099324 CAAGTGCTTAAGAGAGTGTCTGG - Intronic
1035605342 8:926659-926681 CATGAGCTGAAGGGGGTGTGCGG + Intergenic
1035737620 8:1900021-1900043 CAAGTGCTGACTGTGTTGTGAGG + Intronic
1036593719 8:10193266-10193288 CATGCGCTGAATGGGGTCTAAGG - Intronic
1041303271 8:56434938-56434960 GAAGTCCTGAATGGAGTGTTGGG - Intergenic
1044303352 8:90610114-90610136 CAAGTGCTGAGTGGGGTGACTGG + Intergenic
1047110917 8:121788361-121788383 CAAGTGGTAACTGGGGTGGCTGG - Intergenic
1051360351 9:16276548-16276570 AAAGTACTGATTGGGGTCTCTGG - Intergenic
1062446035 9:136595369-136595391 CAAGTTGAGAATGGGGTGCCAGG + Intergenic
1062459769 9:136658118-136658140 CAAGTGCTGACAAGGGTGTGGGG + Intergenic
1191043720 X:56113789-56113811 CCAGAGCTGTATGAGGTGTCTGG + Intergenic
1195152850 X:102091232-102091254 GAAGTCCTGAATGAAGTGTCAGG - Intergenic
1195846527 X:109235014-109235036 CCAGTGCTGAAAGTGGGGTCTGG - Intergenic
1197632059 X:128872673-128872695 CAAGAACAGAATGGTGTGTCAGG - Intergenic
1197710187 X:129660496-129660518 CAAGTGTTGGAGGTGGTGTCTGG + Intergenic