ID: 1150651016

View in Genome Browser
Species Human (GRCh38)
Location 17:67010198-67010220
Sequence ACTCGCTGTCCCAGTGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150651003_1150651016 21 Left 1150651003 17:67010154-67010176 CCAGCCAAGCTCTGCCTTTGTCC 0: 1
1: 0
2: 4
3: 34
4: 331
Right 1150651016 17:67010198-67010220 ACTCGCTGTCCCAGTGGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 88
1150651004_1150651016 17 Left 1150651004 17:67010158-67010180 CCAAGCTCTGCCTTTGTCCCCAT 0: 1
1: 1
2: 6
3: 46
4: 590
Right 1150651016 17:67010198-67010220 ACTCGCTGTCCCAGTGGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 88
1150651009_1150651016 -7 Left 1150651009 17:67010182-67010204 CCTACCCTCCCTGACTACTCGCT 0: 1
1: 0
2: 0
3: 14
4: 171
Right 1150651016 17:67010198-67010220 ACTCGCTGTCCCAGTGGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 88
1150651000_1150651016 30 Left 1150651000 17:67010145-67010167 CCTTGCTCCCCAGCCAAGCTCTG 0: 1
1: 0
2: 2
3: 59
4: 530
Right 1150651016 17:67010198-67010220 ACTCGCTGTCCCAGTGGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 88
1150651002_1150651016 22 Left 1150651002 17:67010153-67010175 CCCAGCCAAGCTCTGCCTTTGTC 0: 1
1: 0
2: 8
3: 31
4: 345
Right 1150651016 17:67010198-67010220 ACTCGCTGTCCCAGTGGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 88
1150651008_1150651016 -2 Left 1150651008 17:67010177-67010199 CCATGCCTACCCTCCCTGACTAC 0: 1
1: 0
2: 1
3: 21
4: 309
Right 1150651016 17:67010198-67010220 ACTCGCTGTCCCAGTGGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 88
1150651007_1150651016 -1 Left 1150651007 17:67010176-67010198 CCCATGCCTACCCTCCCTGACTA 0: 1
1: 0
2: 0
3: 7
4: 146
Right 1150651016 17:67010198-67010220 ACTCGCTGTCCCAGTGGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 88
1150651001_1150651016 23 Left 1150651001 17:67010152-67010174 CCCCAGCCAAGCTCTGCCTTTGT 0: 1
1: 0
2: 3
3: 28
4: 309
Right 1150651016 17:67010198-67010220 ACTCGCTGTCCCAGTGGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 88
1150651005_1150651016 7 Left 1150651005 17:67010168-67010190 CCTTTGTCCCCATGCCTACCCTC 0: 1
1: 1
2: 3
3: 34
4: 346
Right 1150651016 17:67010198-67010220 ACTCGCTGTCCCAGTGGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 88
1150651006_1150651016 0 Left 1150651006 17:67010175-67010197 CCCCATGCCTACCCTCCCTGACT 0: 1
1: 0
2: 2
3: 25
4: 341
Right 1150651016 17:67010198-67010220 ACTCGCTGTCCCAGTGGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150651016 Original CRISPR ACTCGCTGTCCCAGTGGTGT GGG Intronic
900629885 1:3628847-3628869 TCTCGCTGTCCCTGTGCTGCTGG + Exonic
901346901 1:8552859-8552881 ACGTGCTGGCCCAGTGGTGCAGG - Intronic
901738938 1:11329790-11329812 ACTGGGTGTCCCTGGGGTGTGGG + Intergenic
902554060 1:17236493-17236515 ACTTGTAGTCCCAGTGCTGTGGG + Intronic
902788599 1:18749674-18749696 GCTGGCTGTCCCATTGATGTGGG + Intergenic
904347613 1:29883485-29883507 ACTAGCTGTCCCAGTGAGGTAGG + Intergenic
904388264 1:30161775-30161797 ACTCGCTGCCCCAGTGGACAGGG + Intergenic
905656310 1:39688253-39688275 ACTTGCTGTCTCAGAGGTGCTGG - Intronic
911961031 1:104302177-104302199 AGTTGCAGTCCCAGTGGTGATGG + Intergenic
912543906 1:110437389-110437411 CTGCTCTGTCCCAGTGGTGTGGG + Intergenic
918472072 1:184885014-184885036 CCTCACTGTCCCTGTGATGTTGG - Intronic
922222640 1:223620150-223620172 AAGCGCTGTCCCATTGGTGATGG - Intronic
922976865 1:229792392-229792414 ACTTGCAGTTCCAGTGGGGTAGG - Intergenic
924275531 1:242382374-242382396 ACTCTCTGACACAGTGCTGTAGG - Intronic
1069859842 10:71463535-71463557 ACTCCCTCTCCCAGCGCTGTGGG - Intronic
1070282716 10:75061666-75061688 TCCCGCTGTCCCAGTGGGGTGGG + Intergenic
1073187998 10:101628551-101628573 ACTAGCTTTCCCAGCTGTGTAGG - Intronic
1074753652 10:116609471-116609493 ACTCGCTGTCCCCGTCAGGTCGG + Intergenic
1075156468 10:119980870-119980892 ACTCTCTGGGCCAATGGTGTGGG + Intergenic
1079243620 11:18737851-18737873 ACTCACTGTCCCAGAGGGATGGG - Intronic
1081995329 11:47359999-47360021 ACTCGCTGTGCACGTGGTGGGGG + Exonic
1083295013 11:61710521-61710543 TCAAGCTGTCCCAGGGGTGTTGG + Intronic
1083872827 11:65500736-65500758 ACTCGCTTTCCCTGTGGCCTTGG - Intergenic
1084548008 11:69823967-69823989 ACTCGCTCTGCCTGGGGTGTGGG - Intergenic
1087017158 11:93565064-93565086 ACTCGCTGTCCCCTTGGCCTTGG - Intergenic
1088599020 11:111459599-111459621 ACTCCCTCTCCCCCTGGTGTTGG + Intergenic
1092505076 12:9090428-9090450 CCTAGCTGTCCCAGTGGAGAAGG - Exonic
1097529541 12:60780990-60781012 ACTCAAGGCCCCAGTGGTGTGGG + Intergenic
1104313913 12:127679505-127679527 ACTCACTGTAACAGTGGGGTGGG + Intergenic
1105715112 13:23055649-23055671 CCTCATTGTCCCAGTGGTGCAGG + Intergenic
1105769366 13:23594131-23594153 ACTCAGGGCCCCAGTGGTGTAGG - Intronic
1108313283 13:49216196-49216218 ACTGGCTGTCCCAGTGACCTGGG + Intergenic
1108740472 13:53332161-53332183 ACTAGTTTTCCCATTGGTGTGGG + Intergenic
1113803405 13:113098118-113098140 ATTCGCTGTCCCCGTGCTGCTGG + Intronic
1116231758 14:42227424-42227446 ACTCTCTTTCCCAGGGGTGTTGG - Intergenic
1120479405 14:85030716-85030738 ACTTACTGTCCCAGATGTGTAGG - Intergenic
1123478702 15:20611876-20611898 ACACGCGGTCCCAGTGGGGCAGG + Intergenic
1123639311 15:22388509-22388531 ACACGCGGTCCCAGTGGGGCAGG - Intergenic
1126454759 15:48849150-48849172 TCTCTCTGTCCCAGTGATCTGGG + Intronic
1127042327 15:54990837-54990859 ACCCAAGGTCCCAGTGGTGTGGG - Intergenic
1127711515 15:61603696-61603718 ACTAGCTTTTCCAGTGGGGTAGG - Intergenic
1129239751 15:74244380-74244402 AATCCCTGCCCCACTGGTGTGGG - Intronic
1133055096 16:3141837-3141859 ACCCGCGGTCCCACAGGTGTGGG - Exonic
1141503381 16:84459935-84459957 ACAAGCTGGCCAAGTGGTGTGGG + Intronic
1141730995 16:85822787-85822809 CTTCTCTCTCCCAGTGGTGTTGG - Intergenic
1146904925 17:36612184-36612206 TTTCCCTGTCCCAGTGGTCTGGG + Intergenic
1150651016 17:67010198-67010220 ACTCGCTGTCCCAGTGGTGTGGG + Intronic
1155440025 18:25852282-25852304 TCTTGCTGTCCGAGTGCTGTTGG - Intergenic
1158133377 18:54177984-54178006 ACTAGCTGGCGCAGTGGTGTGGG - Intronic
1160423244 18:78763427-78763449 ACATGCTGTCCCTGCGGTGTGGG + Intergenic
1160860005 19:1233734-1233756 CCTCTCTGTCCCAGTGATGGGGG - Intronic
1162508819 19:11104755-11104777 ACTATCTGGACCAGTGGTGTGGG - Intronic
1165738541 19:38192627-38192649 ACTCTCAGTCCCTGTGGTTTGGG - Intronic
1167632059 19:50631520-50631542 CCTGGCTGTCCCCTTGGTGTGGG + Intronic
925754412 2:7119896-7119918 ACCACCTTTCCCAGTGGTGTTGG - Intergenic
1175987476 20:62771164-62771186 ACTCGCTGTCCCTGGGGAGGCGG - Intergenic
1180915140 22:19480389-19480411 CCTCCCTGTCCCAACGGTGTGGG + Intronic
1182796738 22:32996498-32996520 ACTCACTGTCTCTGTGGTCTTGG - Intronic
1183224012 22:36536878-36536900 ACCCGCTTTCCCAGCTGTGTGGG - Intergenic
1183340172 22:37275751-37275773 AGTCACTGTCCCTGTGTTGTAGG - Intergenic
1183401804 22:37609134-37609156 ACTCGCCGTCCCAGGGGTCATGG - Intronic
1184396512 22:44245090-44245112 TCTGACTGTCCCAGTGCTGTGGG + Exonic
1185327328 22:50233280-50233302 ACTCCCCGCCACAGTGGTGTGGG - Intronic
952190624 3:31019198-31019220 CTTCACTGTCCCAGTGGTATTGG - Intergenic
955413440 3:58670792-58670814 ACTCTCTGGCCCAGTGGTGCGGG + Intergenic
959188993 3:103085472-103085494 ATTCTCTCTCCCAGGGGTGTTGG - Intergenic
960987861 3:123292273-123292295 CCTGGCTGTCCCTGTGGTGGTGG + Intronic
961811309 3:129523351-129523373 TCTCCCAGTCCCAGTGCTGTGGG - Intergenic
967879027 3:194286150-194286172 ACTCTCTTTCCAAGGGGTGTGGG - Intergenic
974093363 4:57335489-57335511 ACTCCCTGCCCCACTGATGTTGG - Intergenic
981140334 4:141260069-141260091 CAACGCTGTCCCAGTGGTGGTGG + Intergenic
981424757 4:144590374-144590396 ACTTCTTGTCCCAGTGGTTTTGG - Intergenic
985814125 5:2113955-2113977 ACTCACGATCCCAGAGGTGTGGG - Intergenic
987903699 5:24049344-24049366 ATTTGGTGTCCCAGTGGTGGGGG - Intronic
989354746 5:40530609-40530631 ACTTTCTGTCCAAGTGCTGTAGG + Intergenic
1000167772 5:158671883-158671905 CCTCACTTTCCCATTGGTGTGGG - Intergenic
1000834040 5:166133791-166133813 ACTCATTAACCCAGTGGTGTGGG - Intergenic
1003082912 6:3036903-3036925 ACTATCTGGGCCAGTGGTGTGGG - Intergenic
1004620133 6:17324518-17324540 CCTCGTTAACCCAGTGGTGTAGG - Intergenic
1007568041 6:42868276-42868298 ACTCGCTGTCAGTGTGGTGTGGG + Exonic
1019540821 7:1550253-1550275 GCTCCCTGTCCCAGGTGTGTGGG + Intronic
1019705424 7:2495082-2495104 ATTCGCGGTCCAAGTGGTGTGGG + Intergenic
1026284140 7:68948347-68948369 TCTTGCTGTCCCAGGGGTGGCGG - Intergenic
1031470931 7:122168548-122168570 ACTGGCTTTCCATGTGGTGTGGG - Intergenic
1035162654 7:156962417-156962439 AGGGGCTGTCCCAGTGGTCTGGG + Intronic
1040590423 8:48787846-48787868 ATTCCCTGTCCCAGTGGAGCTGG + Intergenic
1040959692 8:53018941-53018963 ACTCTGGGCCCCAGTGGTGTGGG - Intergenic
1044464340 8:92486119-92486141 ACTCGGAATCCCAGTGGAGTAGG + Intergenic
1061945142 9:133904606-133904628 ACACCCTCTCCCAGTGGAGTCGG + Intronic
1061970103 9:134040309-134040331 CCACGCAGCCCCAGTGGTGTGGG - Intronic
1062540223 9:137038760-137038782 ACTCTCTGTCCCACTGATGCTGG - Intergenic
1187546029 X:20253187-20253209 ACTCCCCAACCCAGTGGTGTGGG - Intronic
1187685753 X:21814142-21814164 ACTAGCTGCCCCTGGGGTGTAGG - Intergenic
1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG + Intergenic
1191633488 X:63350998-63351020 ACACGCTGTCCCAGTGCTCACGG - Exonic
1191724155 X:64261290-64261312 ATTCACTGGCCCAGTGGTTTTGG - Intergenic