ID: 1150651304

View in Genome Browser
Species Human (GRCh38)
Location 17:67012072-67012094
Sequence AAGAATCCTCTATAGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 169}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150651304_1150651311 -2 Left 1150651304 17:67012072-67012094 CCCTGCTTCTATAGAGGATTCTT 0: 1
1: 0
2: 2
3: 11
4: 169
Right 1150651311 17:67012093-67012115 TTGGAAAGGCTGCATTGGGGCGG 0: 1
1: 0
2: 2
3: 19
4: 276
1150651304_1150651315 15 Left 1150651304 17:67012072-67012094 CCCTGCTTCTATAGAGGATTCTT 0: 1
1: 0
2: 2
3: 11
4: 169
Right 1150651315 17:67012110-67012132 GGGCGGTGTGGGAGGAGCACTGG 0: 1
1: 0
2: 2
3: 49
4: 583
1150651304_1150651314 7 Left 1150651304 17:67012072-67012094 CCCTGCTTCTATAGAGGATTCTT 0: 1
1: 0
2: 2
3: 11
4: 169
Right 1150651314 17:67012102-67012124 CTGCATTGGGGCGGTGTGGGAGG 0: 1
1: 0
2: 4
3: 35
4: 299
1150651304_1150651312 3 Left 1150651304 17:67012072-67012094 CCCTGCTTCTATAGAGGATTCTT 0: 1
1: 0
2: 2
3: 11
4: 169
Right 1150651312 17:67012098-67012120 AAGGCTGCATTGGGGCGGTGTGG 0: 1
1: 0
2: 1
3: 9
4: 201
1150651304_1150651313 4 Left 1150651304 17:67012072-67012094 CCCTGCTTCTATAGAGGATTCTT 0: 1
1: 0
2: 2
3: 11
4: 169
Right 1150651313 17:67012099-67012121 AGGCTGCATTGGGGCGGTGTGGG 0: 1
1: 0
2: 1
3: 19
4: 190
1150651304_1150651316 21 Left 1150651304 17:67012072-67012094 CCCTGCTTCTATAGAGGATTCTT 0: 1
1: 0
2: 2
3: 11
4: 169
Right 1150651316 17:67012116-67012138 TGTGGGAGGAGCACTGGACAAGG 0: 1
1: 2
2: 5
3: 73
4: 521
1150651304_1150651309 -6 Left 1150651304 17:67012072-67012094 CCCTGCTTCTATAGAGGATTCTT 0: 1
1: 0
2: 2
3: 11
4: 169
Right 1150651309 17:67012089-67012111 ATTCTTGGAAAGGCTGCATTGGG 0: 1
1: 0
2: 0
3: 32
4: 255
1150651304_1150651308 -7 Left 1150651304 17:67012072-67012094 CCCTGCTTCTATAGAGGATTCTT 0: 1
1: 0
2: 2
3: 11
4: 169
Right 1150651308 17:67012088-67012110 GATTCTTGGAAAGGCTGCATTGG 0: 1
1: 0
2: 1
3: 20
4: 156
1150651304_1150651310 -5 Left 1150651304 17:67012072-67012094 CCCTGCTTCTATAGAGGATTCTT 0: 1
1: 0
2: 2
3: 11
4: 169
Right 1150651310 17:67012090-67012112 TTCTTGGAAAGGCTGCATTGGGG 0: 1
1: 0
2: 3
3: 24
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150651304 Original CRISPR AAGAATCCTCTATAGAAGCA GGG (reversed) Intronic
903629133 1:24753191-24753213 AAGAATACTTTATATAAGCAAGG + Intronic
907332433 1:53679854-53679876 AAGTATCCTCTTTACAAGAAAGG - Intronic
909850041 1:80450071-80450093 TAGAATCCTATGTAGAACCATGG + Intergenic
910223296 1:84911629-84911651 AACAATCCACCATAGGAGCATGG - Intergenic
915384780 1:155480301-155480323 AAGAAAACACTTTAGAAGCAGGG + Exonic
916181472 1:162087647-162087669 AAGAATCAAATATAGAATCATGG - Intronic
916181864 1:162091928-162091950 AAGAATCAAATATAGAATCACGG + Intronic
918081991 1:181214795-181214817 AAGACTCCTCTGAAGAAGCGAGG - Intergenic
919737992 1:200965512-200965534 TAGAATCCTTCAGAGAAGCAAGG + Intergenic
922071799 1:222202408-222202430 AATATTCCTAGATAGAAGCATGG + Intergenic
1063882056 10:10541332-10541354 AAGAACCCTCTCTTGAAGCCTGG - Intergenic
1064511337 10:16096194-16096216 AAGAAAACTCCATAGAAACAGGG + Intergenic
1064823340 10:19364863-19364885 AAGAATCCTCAATTGAATTAAGG - Intronic
1064824875 10:19387045-19387067 AAGATACCTCCTTAGAAGCACGG - Intronic
1075212353 10:120502025-120502047 AAAATTCCTCTAGAGCAGCATGG - Intronic
1075958937 10:126550249-126550271 AAGAATGCTGTATAGGAGCCAGG - Intronic
1078884180 11:15483512-15483534 AGCAATCCCCTATAGAAGTAGGG + Intergenic
1085140718 11:74138915-74138937 AAGAATCCTTTATTGTATCAGGG + Exonic
1085364067 11:75921604-75921626 AAAAAATATCTATAGAAGCAAGG - Intronic
1086873015 11:92062275-92062297 ATTACTCCTCTATAGAAGGAGGG - Intergenic
1088790648 11:113223362-113223384 AAGAATTCTCTTTAGAAGGCTGG + Intronic
1089712677 11:120327275-120327297 AAGAATCTTCTATTTAAGTATGG - Exonic
1089909444 11:122081430-122081452 AACAATCCTCTATATAAGGTGGG - Intergenic
1091388143 12:108123-108145 AAGGAAACTCTATAGAAGCTAGG - Intronic
1091826487 12:3516753-3516775 AAGCATCGGCTATCGAAGCAGGG - Intronic
1094192979 12:27715513-27715535 TAGATTCCTCCATAGAAGTAAGG - Intronic
1094575545 12:31681847-31681869 AACAATTTTTTATAGAAGCAGGG + Intronic
1096134340 12:49187080-49187102 AAAAATCTTCTATTCAAGCATGG - Intronic
1097091602 12:56509837-56509859 AAGAATCAACTTTAGAAGCTGGG - Intergenic
1098760586 12:74420097-74420119 AAGAATCATCTCTGTAAGCAGGG - Intergenic
1100104611 12:91154791-91154813 AGGATTACTCTATAGAAGTAAGG - Intronic
1101219556 12:102623815-102623837 AAAAATCCTCTATAGATGCACGG + Intergenic
1101319146 12:103657911-103657933 AACAGTCCTCTTTAGAAGAAGGG + Intronic
1106304778 13:28499842-28499864 ATGAAGGCTCTATAGAAACATGG - Intergenic
1107176792 13:37408366-37408388 AAGAATCTTATTTAGAATCAAGG + Intergenic
1107420852 13:40245011-40245033 AAGAATCCTATGTAGCATCATGG + Intergenic
1108550842 13:51542372-51542394 AAGAATACTCTATTGCAGAATGG + Intergenic
1108766489 13:53636994-53637016 AAGAATCCTGAATATAAGAATGG + Intergenic
1111116339 13:83782856-83782878 AAGAATCCACCAAAGAAGAAAGG + Intergenic
1112930612 13:104731833-104731855 AAGATTCCTTCATAGAAGCCTGG + Intergenic
1113817653 13:113185538-113185560 TAGAGTCCTCTATACCAGCACGG + Exonic
1116343005 14:43750703-43750725 AAGAACCCTCTATTGAAGTTTGG - Intergenic
1117311112 14:54524244-54524266 AAGAATGGTCCATAGACGCAAGG - Intronic
1124080597 15:26491163-26491185 AAGTATCCTCTAAAGGAACAGGG + Intergenic
1124197663 15:27647099-27647121 AAGCATCCTGCATAGAAACATGG + Intergenic
1125542625 15:40479070-40479092 ATGAATCCTCTGTTGAAGCAAGG - Intergenic
1129783512 15:78291354-78291376 AAGACTCCAATATATAAGCATGG - Intronic
1129949034 15:79569942-79569964 AAGAATTCACCAAAGAAGCATGG + Intergenic
1135868317 16:26125569-26125591 TAGAATCCTCAAGAAAAGCATGG + Intronic
1136047524 16:27626226-27626248 ATGAAGACTCTATAGAAACATGG - Intronic
1137793278 16:51193272-51193294 AAGAAGGTTCTGTAGAAGCACGG - Intergenic
1139782716 16:69365040-69365062 ATGAATCCCCTAAAGCAGCAGGG - Intronic
1141544833 16:84758949-84758971 AATAATCCTGTTTATAAGCAAGG - Intronic
1149803233 17:59590115-59590137 AAGAATTCTCTAAGGATGCAAGG - Intronic
1149843255 17:59985374-59985396 AAGAATTCTCTAAGGATGCAAGG + Intergenic
1150231202 17:63551539-63551561 GAGAATCCTTTATAGAAGCACGG + Intronic
1150651304 17:67012072-67012094 AAGAATCCTCTATAGAAGCAGGG - Intronic
1151157441 17:72135771-72135793 AAGAATTCTCCATGGAGGCAGGG - Intergenic
1153812473 18:8764286-8764308 AAGAATGCTTTATATAAGGAAGG + Intronic
1156905121 18:42343239-42343261 AAGAATCTTAGATAGAAGCAGGG + Intergenic
1165278547 19:34775903-34775925 AAGAATCCTATTTAGAGTCAAGG + Intergenic
925052558 2:828604-828626 AAGGGTCCTCTGTAGAAGGATGG - Intergenic
926283420 2:11468532-11468554 AAGAATACTTTATAGAAGGCCGG + Intergenic
926314368 2:11698354-11698376 AAAAATCCTCTTTAGAGTCAAGG + Intronic
928731903 2:34241105-34241127 AAGAATCCTCTGGAGTAGCTGGG - Intergenic
929438986 2:41950654-41950676 AAGAATCCTCCATAGCTTCAGGG + Intronic
929529890 2:42743126-42743148 AAGAATCCTGGAGAGAAGAAAGG + Intronic
931067782 2:58606101-58606123 TAGAATCCTCTTTAGAGGCAAGG - Intergenic
931145688 2:59514707-59514729 AAGGATCATCTGTAGAAGCTGGG + Intergenic
931957795 2:67447469-67447491 AAGACTCCTCCATAGACTCAGGG - Intergenic
933668589 2:84985301-84985323 AAGACCTTTCTATAGAAGCAGGG - Intronic
933768719 2:85729468-85729490 AAAAATCCTCTATAAAACCCAGG + Intergenic
933932503 2:87168105-87168127 ATGAATCCTCTGTAAATGCAAGG + Intergenic
935623872 2:105152406-105152428 AAGTCTTCTCTAAAGAAGCAAGG - Intergenic
936436727 2:112514051-112514073 AATAATCCTAGATAAAAGCAAGG - Intronic
939007838 2:136809730-136809752 GAGAATTCTCTGTGGAAGCAAGG + Intronic
939555550 2:143668808-143668830 AAGAATTCTCCATAAAATCAAGG + Intronic
940925879 2:159363197-159363219 AAGCATCCAGTTTAGAAGCAGGG - Intronic
943442501 2:187943210-187943232 CACAGTCCTCTACAGAAGCAAGG + Intergenic
946185088 2:217976277-217976299 ATGAATCCTGCCTAGAAGCAGGG + Intronic
1169771241 20:9203318-9203340 AAGACAGCTGTATAGAAGCAGGG - Intronic
1170826514 20:19800731-19800753 ATGAATCTGCTATAGGAGCAGGG - Intergenic
1171343886 20:24451326-24451348 AAAAATCCTCTTGAGAAGCCAGG - Intergenic
1171770802 20:29320820-29320842 CAGAAACCTCCAGAGAAGCATGG + Intergenic
1174221232 20:48957182-48957204 AAGACTCCTCTTTAGAAGGGGGG - Intronic
1177327862 21:19615618-19615640 AGGAGGCCTCCATAGAAGCAGGG + Intergenic
1177372194 21:20218603-20218625 AGGGATCCGCTGTAGAAGCAGGG + Intergenic
1178215280 21:30590262-30590284 AGGAATCTTCCATAGGAGCACGG + Exonic
1178760413 21:35396671-35396693 CAGGATCCTCCATAGAAGCAGGG - Intronic
1181076151 22:20378316-20378338 AAGAATCCCCTGAAGAAGGAAGG + Intronic
1182587697 22:31354650-31354672 ATGCAGGCTCTATAGAAGCATGG + Intergenic
949221356 3:1637666-1637688 AAGAATCCTCTTTTGAAGTCTGG + Intergenic
949231420 3:1755307-1755329 ATGAATCCACTGCAGAAGCATGG + Intergenic
951034214 3:17915187-17915209 ATGTATCCTCTATGGATGCAGGG - Intronic
951983821 3:28595635-28595657 AAGTATATTCTCTAGAAGCAGGG + Intergenic
953015955 3:39076274-39076296 AGTAATCCTTTAGAGAAGCAAGG + Intronic
953102479 3:39843101-39843123 AAGAAGCCTCCATGGAAGGAGGG - Intronic
957807602 3:85170038-85170060 AAGAACCCTCAATAGAAATATGG + Intronic
957947848 3:87087792-87087814 AAGGTTTCTCTATAGGAGCAGGG - Intergenic
958785767 3:98594505-98594527 AAGTAGGCACTATAGAAGCAAGG - Intergenic
958883440 3:99698936-99698958 AGGAATGCTCCATAGAAGCGGGG + Intronic
959900638 3:111657704-111657726 AAGAACCCTGTGTAGATGCAGGG + Intronic
959932180 3:111997002-111997024 TTGTATCCTCTCTAGAAGCATGG + Intergenic
960773922 3:121227145-121227167 AAGTATCCTCTATTGAACAAAGG - Intronic
961405866 3:126679210-126679232 AAGAATCCTCTACTGATGCCAGG - Intergenic
962127833 3:132640985-132641007 AAGCTTTCTCTATATAAGCAAGG + Intronic
962838828 3:139215194-139215216 CAGAATCCTCCAGAGAACCATGG + Intronic
962956360 3:140270581-140270603 ATGAATCCTCTATATGAGCCTGG + Intronic
964018640 3:151979192-151979214 AAGAATACAGTATAGATGCAGGG - Intergenic
964265585 3:154891485-154891507 AAGAAATCACTTTAGAAGCAAGG + Intergenic
964960482 3:162417762-162417784 AGGAATTCTCTAGAGAAGGAGGG - Intergenic
967719732 3:192803010-192803032 AAGACTCGTCTATATAATCAGGG + Intronic
970656875 4:18241029-18241051 ATGCATCCTCTTTAAAAGCAGGG - Intergenic
970778918 4:19711807-19711829 AAGTAACCTTTATTGAAGCAAGG + Intergenic
971046519 4:22811118-22811140 CAGAAGCCAGTATAGAAGCATGG - Intergenic
971542405 4:27835965-27835987 AAAAAGCATCTATAGAAACATGG - Intergenic
973164413 4:47058662-47058684 AAATATCCCCTATGGAAGCAAGG - Intronic
973315482 4:48755611-48755633 AATAATCCTCTCTAAAAACAAGG + Intronic
978774018 4:112487533-112487555 TAGAATCCTCTACAGCCGCAGGG + Intergenic
979600173 4:122578883-122578905 ACGAAGCATCTATAGCAGCATGG - Intergenic
981661864 4:147176492-147176514 AAGATTCCTCTATATAAAAAAGG + Intergenic
986048387 5:4063443-4063465 AAGAATGCCCTAAACAAGCATGG + Intergenic
986264997 5:6183617-6183639 AAGGAACCACTGTAGAAGCAAGG + Intergenic
987139301 5:14929236-14929258 TAGAACCCTCTTTAGAAGGAGGG - Intergenic
987647453 5:20692714-20692736 AATAAATTTCTATAGAAGCAAGG + Intergenic
989376208 5:40764432-40764454 AAGAAGCCTCAAAAGAATCAAGG + Intronic
990507668 5:56460559-56460581 AAGCAGCTTCTAAAGAAGCAAGG - Intronic
991256101 5:64616947-64616969 AAGATCCATCAATAGAAGCATGG + Intergenic
991567997 5:68024784-68024806 AAGAGTCCTCTTTAAAAGCCTGG + Intergenic
992414688 5:76540817-76540839 AAGATTCCTTTAGAGCAGCAAGG + Intronic
994020501 5:95018663-95018685 AGGAATCATTTATAGAAACAAGG - Intronic
994083907 5:95738115-95738137 AAGCATCCTCAAAAGAAGAATGG - Intronic
994979281 5:106852495-106852517 AAAAATCATCAATAAAAGCAGGG + Intergenic
998416914 5:141952791-141952813 AAAAATCCTCTGCAAAAGCAAGG + Intronic
998666095 5:144298985-144299007 AAGAATTCTCTAAAGAGGCCAGG + Intronic
1000217147 5:159170997-159171019 AAGATAACTATATAGAAGCATGG - Intronic
1000567361 5:162866536-162866558 AAGATTCCTCTAATGAAGAAAGG + Intergenic
1001560316 5:172664962-172664984 AAGCTTCCCCTATAGAAACAAGG + Intronic
1002157757 5:177296147-177296169 AGGTCTCCTCTATAGATGCAAGG + Exonic
1006807376 6:36797489-36797511 AAGAATCGTTTATACAGGCAAGG + Intronic
1009276985 6:61695402-61695424 TAGAATCCTCTAGAGAAGGATGG - Intronic
1010288384 6:74106822-74106844 AGGAAACCTCTGTAGAAGCTGGG + Intergenic
1012265719 6:97139535-97139557 AAGAATGCTCTAAAGACCCATGG - Exonic
1012951285 6:105520666-105520688 ATGAATCCACTATAGAGGAATGG + Intergenic
1014490817 6:122059335-122059357 AATAATCCTCTAAAGTAGCATGG + Intergenic
1015973789 6:138769042-138769064 AAGATTATTCTATAGAAGAATGG - Intronic
1017846543 6:158263442-158263464 AAAAATACTCTAGAGAAGAAAGG + Intronic
1019835964 7:3383640-3383662 AAGAATTCTTTAAAGAGGCATGG + Intronic
1021148836 7:17124135-17124157 AAGAACCTGCTATAGAAGTAAGG + Intergenic
1027629033 7:80579497-80579519 AAAAATCCTTTATTGAAACAAGG + Intronic
1030145935 7:106355765-106355787 AAGAATGCTCCACTGAAGCATGG + Intergenic
1034078218 7:148252668-148252690 GAGAAGCCTCTATAGAAGGATGG - Intronic
1034758291 7:153644728-153644750 AATAATCCTCTATATTTGCATGG + Intergenic
1035384444 7:158461057-158461079 CAGAATCCTCCATAGTAGAAAGG - Intronic
1037195731 8:16186989-16187011 AAGAATCCTCTTAAAAAGTAAGG + Intronic
1038985188 8:32801349-32801371 GAGAATCCACTATGGAAGCCAGG + Intergenic
1041640945 8:60200937-60200959 AACAATCCTATGTAGAAGAAAGG + Intronic
1045574130 8:103400317-103400339 AAGAATTCTGCATAGAAACATGG - Exonic
1046969183 8:120202434-120202456 AAGGAGGTTCTATAGAAGCAAGG - Intronic
1047917852 8:129602410-129602432 AATAATCCTCAACAGAAGAATGG - Intergenic
1048251261 8:132868596-132868618 AAGTATCCTCTTGAGAAGCTGGG + Intronic
1049860717 8:144896717-144896739 ACGAGTCCTCTATAGATGCCAGG + Intronic
1051143604 9:14004041-14004063 AAGAATCCTATATAATACCAAGG - Intergenic
1051377503 9:16418478-16418500 AAGAATCTTCAATTAAAGCATGG - Exonic
1051713656 9:19958902-19958924 AAGAATCATGTATTAAAGCAGGG - Intergenic
1052157551 9:25212967-25212989 AAGAATGCTCTGTTGATGCAAGG + Intergenic
1055468676 9:76590490-76590512 AAGAATCCTCTCAGGAAGCAGGG - Intergenic
1059951841 9:119472522-119472544 AAGCATTCTCAATAGAAGAATGG + Intergenic
1187073826 X:15914610-15914632 AAGAACTCTCTATAAAGGCAAGG - Intergenic
1187728088 X:22224373-22224395 CAGAATCCTCTGTGGAATCAGGG - Intronic
1189533994 X:41917458-41917480 AAGAATAATCTCAAGAAGCAAGG + Intronic
1190531132 X:51377625-51377647 AAGAAGCCTCTATAGAAGATGGG - Intergenic
1190549583 X:51564971-51564993 AAGAAACCTGTATATAAGGAGGG - Intergenic
1193077046 X:77365153-77365175 AAGCATCACCTATAGTAGCATGG - Intergenic
1195807977 X:108796726-108796748 AAAAATCCTTTGAAGAAGCAAGG - Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1197038272 X:121904078-121904100 AAGAAGTCTCCATAGACGCAGGG - Intergenic
1197551186 X:127894648-127894670 AAGAATTCTCTGAAGCAGCAAGG - Intergenic
1198031865 X:132761058-132761080 AAGAATCTTCCATATATGCAAGG + Intronic
1198814197 X:140569859-140569881 AATAATCATCTATAGAAGAATGG + Intergenic
1198859361 X:141053066-141053088 AAGAATCTTCTCTAGATGGAGGG + Intergenic
1198903334 X:141534326-141534348 AAGAATCTTCTCTAGATGGAGGG - Intergenic
1198964416 X:142212423-142212445 ATGAATTCACTATAGATGCATGG - Intergenic