ID: 1150651456

View in Genome Browser
Species Human (GRCh38)
Location 17:67012995-67013017
Sequence CAGGATTCCCTTAATGACGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150651452_1150651456 -3 Left 1150651452 17:67012975-67012997 CCCTCTGACATGCTTTTCTCCAG 0: 1
1: 0
2: 2
3: 34
4: 353
Right 1150651456 17:67012995-67013017 CAGGATTCCCTTAATGACGATGG 0: 1
1: 0
2: 0
3: 4
4: 47
1150651453_1150651456 -4 Left 1150651453 17:67012976-67012998 CCTCTGACATGCTTTTCTCCAGG 0: 1
1: 1
2: 2
3: 17
4: 262
Right 1150651456 17:67012995-67013017 CAGGATTCCCTTAATGACGATGG 0: 1
1: 0
2: 0
3: 4
4: 47
1150651451_1150651456 11 Left 1150651451 17:67012961-67012983 CCATCAGCAAGTTGCCCTCTGAC 0: 1
1: 0
2: 1
3: 9
4: 148
Right 1150651456 17:67012995-67013017 CAGGATTCCCTTAATGACGATGG 0: 1
1: 0
2: 0
3: 4
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150651456 Original CRISPR CAGGATTCCCTTAATGACGA TGG Intronic
907480273 1:54740931-54740953 CACGATTCCCTCTATGAGGAAGG - Intronic
909973163 1:82015144-82015166 CAGATTTCCCTTTATGACCATGG - Intergenic
911536451 1:99106112-99106134 CAGGGTTCCCTTAAGGCCCAAGG - Intergenic
914738545 1:150442640-150442662 GAGGACTCCCTTAATCATGATGG - Intronic
919184148 1:194121935-194121957 CATTAATCCCTTAATGAGGAAGG + Intergenic
919905928 1:202078297-202078319 CAGAATTCCCTGAATGAGGCAGG - Intergenic
920258354 1:204672035-204672057 AAGGCTTCCCTGAATGAAGAGGG + Intronic
1062986260 10:1772097-1772119 CAGGAATTTCTTAATGAAGAGGG + Intergenic
1072484682 10:95843878-95843900 CAGGGTTGTCTTAATGAAGATGG - Intronic
1080432774 11:32214098-32214120 CAGGATTCCCTGAAAGCCTAGGG - Intergenic
1089866065 11:121632830-121632852 CATGACTCCCTTCATGAAGAAGG - Exonic
1119912536 14:78363067-78363089 AAGGATTCCCTAAATGAGGTGGG - Intronic
1120282745 14:82459898-82459920 CAGGATTTCCAAAATGTCGAAGG - Intergenic
1120631667 14:86899187-86899209 CAGGGTTCCCATAAAGACCAGGG - Intergenic
1128227629 15:66013221-66013243 CATGCTTCCCTGACTGACGATGG - Intronic
1131802994 15:96091168-96091190 TAGCATTCCTTTAAGGACGATGG - Intergenic
1150651456 17:67012995-67013017 CAGGATTCCCTTAATGACGATGG + Intronic
1165100174 19:33434577-33434599 CAGGATTCCCCGCAGGACGAGGG + Intronic
1168505292 19:56928920-56928942 CAGGATTCCTTTAATGGGAAGGG + Intergenic
925249630 2:2421502-2421524 CAAGATTCCCTTAAGGCCCAAGG + Intergenic
926211954 2:10877959-10877981 CAGCCTTCCCTTAATGACTCAGG - Intergenic
928352452 2:30572254-30572276 CATGATTGCCTTAATGAAAAAGG + Intronic
937837557 2:126487724-126487746 CAGGTTGCCCTTACTGAAGATGG + Intergenic
941371874 2:164675587-164675609 TAGGATTCCCCAAATGAGGACGG + Intronic
946459236 2:219854361-219854383 CAGGATGCCCCTAGTGACCATGG - Intergenic
948421301 2:237862026-237862048 CAGCATTCCCTGAGTGAAGATGG - Intronic
1170061973 20:12268650-12268672 CAGCATTCCCTTAATAGCAAGGG - Intergenic
1179427737 21:41295351-41295373 CAGGTTTATTTTAATGACGATGG - Intergenic
949833633 3:8244274-8244296 CAGGTTTCCATTAATAAAGAAGG - Intergenic
962022955 3:131518909-131518931 CAGGATTCCCTTAGTAACCAAGG + Intergenic
970006920 4:11419811-11419833 AAGGATGCCATTAATGATGAGGG - Intronic
978925456 4:114237517-114237539 CAAGTCTCCTTTAATGACGAGGG + Intergenic
982271672 4:153596187-153596209 TAGGATGCACTTAATGACAATGG + Intronic
984959305 4:185079106-185079128 CAGAATCCCCTTGATGAAGATGG - Intergenic
986415810 5:7526825-7526847 CTGGAATCCCTTAATGATGAAGG + Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
990683371 5:58271170-58271192 CAGGATTCCTTAACTGAAGAAGG - Intergenic
998152410 5:139764863-139764885 CAGGATACCCTCACTGGCGAAGG + Intergenic
1004253639 6:14043203-14043225 CAGGAGTCCCTGCATGAGGATGG + Intergenic
1010299463 6:74243402-74243424 CAGTATTCCCTTAAGGCCCAGGG + Intergenic
1019688508 7:2396224-2396246 CAGGGTTCTGTTAATGAGGAAGG + Intergenic
1024740083 7:52343851-52343873 CAGGATTCTCTGGATGAAGAAGG - Intergenic
1029010197 7:97252098-97252120 CATGATTCCATTATTGACTATGG - Intergenic
1033502882 7:141971516-141971538 CAGGATTCCCTTAAAGACCTAGG - Intronic
1034525867 7:151661835-151661857 CAGTGTTCCCTTAATGACTCAGG - Intronic
1048384791 8:133902017-133902039 CAGGATTCCCTGAAAGATAAGGG + Intergenic
1051923756 9:22298816-22298838 CAGTGTTCCCTTAATGCCCAAGG + Intergenic
1056550231 9:87646945-87646967 TAGGATTCCCTTACTGCAGAGGG - Intronic
1057693747 9:97309485-97309507 CAGGATACCCATGATGAAGAAGG + Exonic
1202798967 9_KI270719v1_random:155388-155410 CAGGACTTCCTTAATGCCGTTGG + Intergenic
1188216508 X:27485087-27485109 CACGATTTCCTTAATTACCAAGG + Intergenic
1193820091 X:86149974-86149996 CAGGATTCCTTAAATGATGATGG + Intronic