ID: 1150654508

View in Genome Browser
Species Human (GRCh38)
Location 17:67031149-67031171
Sequence CTTTGCACGAAGGTTGTGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 83}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150654499_1150654508 6 Left 1150654499 17:67031120-67031142 CCCTGGCCTCCAGAGGTGGCGTG 0: 1
1: 1
2: 2
3: 150
4: 1627
Right 1150654508 17:67031149-67031171 CTTTGCACGAAGGTTGTGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 83
1150654505_1150654508 -3 Left 1150654505 17:67031129-67031151 CCAGAGGTGGCGTGGGCTGGCTT 0: 1
1: 1
2: 0
3: 10
4: 129
Right 1150654508 17:67031149-67031171 CTTTGCACGAAGGTTGTGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 83
1150654494_1150654508 20 Left 1150654494 17:67031106-67031128 CCAAATGCAGCCCTCCCTGGCCT 0: 1
1: 0
2: 2
3: 44
4: 327
Right 1150654508 17:67031149-67031171 CTTTGCACGAAGGTTGTGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 83
1150654500_1150654508 5 Left 1150654500 17:67031121-67031143 CCTGGCCTCCAGAGGTGGCGTGG 0: 1
1: 0
2: 1
3: 31
4: 254
Right 1150654508 17:67031149-67031171 CTTTGCACGAAGGTTGTGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 83
1150654496_1150654508 10 Left 1150654496 17:67031116-67031138 CCCTCCCTGGCCTCCAGAGGTGG 0: 1
1: 0
2: 3
3: 80
4: 1263
Right 1150654508 17:67031149-67031171 CTTTGCACGAAGGTTGTGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 83
1150654498_1150654508 9 Left 1150654498 17:67031117-67031139 CCTCCCTGGCCTCCAGAGGTGGC 0: 1
1: 0
2: 4
3: 56
4: 797
Right 1150654508 17:67031149-67031171 CTTTGCACGAAGGTTGTGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 83
1150654503_1150654508 0 Left 1150654503 17:67031126-67031148 CCTCCAGAGGTGGCGTGGGCTGG 0: 1
1: 0
2: 1
3: 20
4: 211
Right 1150654508 17:67031149-67031171 CTTTGCACGAAGGTTGTGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150654508 Original CRISPR CTTTGCACGAAGGTTGTGCT GGG Exonic
904411133 1:30325520-30325542 CCCTGCACGGAGATTGTGCTGGG + Intergenic
906816963 1:48889107-48889129 CATAGCAAGAAGGTAGTGCTTGG + Intronic
907027889 1:51139435-51139457 CTTTGTATCAAGGTTATGCTAGG + Intronic
907669388 1:56461470-56461492 CTTTGCAGGCCGGCTGTGCTGGG - Intergenic
909873853 1:80778921-80778943 AGTGGCACGATGGTTGTGCTGGG - Intergenic
909923969 1:81416298-81416320 TTTTGCAAGAAGGTTGTTCAGGG - Intronic
912042156 1:105404826-105404848 CTTTGCTGGAAGGTTGCTCTAGG + Intergenic
913153011 1:116064428-116064450 CTTTTCAGGAATGTTGGGCTTGG + Exonic
914717575 1:150265276-150265298 CCTTGCACCAAGGCTATGCTTGG + Intergenic
917823541 1:178791965-178791987 CTTTGTACAAAGATTGTCCTTGG + Intronic
1064927605 10:20586577-20586599 CATTGCACCAAGGTTATGTTTGG + Intergenic
1067098480 10:43317796-43317818 TTTTGCAGGACGTTTGTGCTGGG + Intergenic
1070867288 10:79713989-79714011 CTCTGCACGCAGGCAGTGCTGGG - Intronic
1070881080 10:79852113-79852135 CTCTGCACGCAGGCAGTGCTGGG - Intergenic
1071634201 10:87236212-87236234 CTCTGCACGCAGGCAGTGCTGGG - Intronic
1071647651 10:87368429-87368451 CTCTGCACGCAGGCAGTGCTGGG - Intronic
1072761114 10:98057602-98057624 CTTTGCACTAAGGCAGTCCTGGG + Intergenic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1085433004 11:76472585-76472607 TTGGGCACGAAGGTTGAGCTTGG - Exonic
1096439341 12:51626393-51626415 CTATGCAGGAAGGTCGTGTTGGG - Intronic
1111075934 13:83235606-83235628 CTTTGCAGGTAGGTTTTACTGGG + Intergenic
1115048593 14:29028550-29028572 CTTTGGATGAAGTTTTTGCTTGG + Intergenic
1118528223 14:66670117-66670139 CTTTGCTCCAAGGTTGAGGTGGG + Intronic
1122273926 14:100581519-100581541 CTTGGCACGCAGGATGGGCTTGG - Intronic
1125884437 15:43218165-43218187 CTTAGCACAAAGCTCGTGCTGGG + Intronic
1131632813 15:94196990-94197012 CTTTGCAGGTCGGCTGTGCTGGG + Intergenic
1138114812 16:54351897-54351919 CTGGGCACCTAGGTTGTGCTAGG - Intergenic
1150654508 17:67031149-67031171 CTTTGCACGAAGGTTGTGCTGGG + Exonic
1158742943 18:60164634-60164656 CTTAGAACGAATGTTGTGGTAGG + Intergenic
1163378752 19:16950411-16950433 CTTCGCTCCAAGGTTGAGCTTGG + Intronic
1163516201 19:17765373-17765395 CTTTGCATGAACCTTGTGCCCGG + Intronic
932628625 2:73319232-73319254 GTGTGAAGGAAGGTTGTGCTGGG - Intergenic
942345328 2:174996833-174996855 CTTTGAAGCAAGGATGTGCTGGG - Intronic
946403638 2:219481659-219481681 CTTTGAACCAAGGATGTTCTAGG - Exonic
946639393 2:221767186-221767208 CTTTGAATGACGGTTATGCTAGG + Intergenic
947329616 2:229014943-229014965 CTTTACATGAAGGTGGTGGTGGG + Intronic
1170836390 20:19888318-19888340 CTTTGCACAAAGGTTTTTTTCGG - Intronic
1171967596 20:31542256-31542278 CTTTGCAGGAAGGATGTCTTGGG - Intronic
1175225867 20:57443487-57443509 CTTTGCAGGATGGTTGTTCACGG - Intergenic
1182927669 22:34141016-34141038 TTTTGCAAGAAGCTTGTGTTGGG - Intergenic
1183383659 22:37503029-37503051 CCAGGCAGGAAGGTTGTGCTTGG - Intronic
1185103584 22:48854757-48854779 CTTTGCATGGAGGGTGAGCTTGG + Intergenic
1185245218 22:49769721-49769743 CTGAGCACCCAGGTTGTGCTTGG - Intergenic
952054604 3:29429435-29429457 CTTTGCTGGAAGGTTCTGTTAGG - Intronic
953472987 3:43182525-43182547 CTTTGCAAGCAGGCTGTGTTAGG - Intergenic
954512550 3:51139081-51139103 CATAGCACCAAGGTTGTACTAGG + Intronic
957082088 3:75645041-75645063 GTTTGCATGAAGGTTTTGCAAGG + Intergenic
957559683 3:81806553-81806575 CTTTGCCCTAAAGTTATGCTAGG + Intergenic
958492221 3:94791475-94791497 ATTTGGAGGAAGATTGTGCTAGG + Intergenic
960934580 3:122890244-122890266 CTCTGCAGGCAGGATGTGCTTGG - Intergenic
965744314 3:171907878-171907900 CTATGGCCGAAGGTTTTGCTAGG + Intronic
968581185 4:1396126-1396148 CTTGGCACTAAGGGGGTGCTGGG + Intergenic
969974682 4:11086533-11086555 CTTGGCACCTAGGTTGTGTTGGG - Intergenic
970580561 4:17470867-17470889 CTTTGCCCAAAGGCTGGGCTGGG - Intronic
971398584 4:26253927-26253949 CTTTGCACCAATGTTGTTTTAGG - Intronic
973106193 4:46341577-46341599 CTTTGCACAAAGGTTCTGTGGGG + Intronic
974293906 4:59969587-59969609 CTTTGCAGGAAGGTGTTGCGTGG - Intergenic
975361737 4:73477978-73478000 CTTTGCATGAAGATTTGGCTGGG - Intergenic
982044696 4:151432298-151432320 CTTGGCACCTATGTTGTGCTAGG + Intronic
987693136 5:21294733-21294755 CGTTGCAGGTAGGGTGTGCTAGG - Intergenic
988837590 5:35048268-35048290 CTCTGCAGGAGGGTGGTGCTGGG + Intergenic
990956272 5:61342931-61342953 CTTTGGAGGATGGTTGTGTTGGG + Intronic
991747142 5:69754823-69754845 CGTTGCAGGTAGGGTGTGCTAGG + Intergenic
991750563 5:69800419-69800441 CGTTGCAGGTAGGGTGTGCTAGG - Intergenic
991798744 5:70334761-70334783 CGTTGCAGGTAGGGTGTGCTAGG + Intergenic
991826518 5:70630136-70630158 CGTTGCAGGTAGGGTGTGCTAGG + Intergenic
991829851 5:70675320-70675342 CGTTGCAGGTAGGGTGTGCTAGG - Intergenic
991891075 5:71334088-71334110 CGTTGCAGGTAGGGTGTGCTAGG + Intergenic
996123096 5:119693021-119693043 CTTTGATCGAAGGTTGTTCCAGG + Intergenic
1016192770 6:141291130-141291152 CTTTACAGGGAGGTTGTGCTGGG - Intergenic
1023820102 7:43975850-43975872 CTGTGCATGAGGCTTGTGCTGGG + Intergenic
1024683306 7:51717271-51717293 CTTTGCACAAAGATTAGGCTGGG - Intergenic
1028889432 7:95970467-95970489 ATCTGCACAAAGGGTGTGCTGGG + Intronic
1029748380 7:102529303-102529325 CTGTGCATGAGGCTTGTGCTGGG + Intergenic
1029766327 7:102628390-102628412 CTGTGCATGAGGCTTGTGCTGGG + Intronic
1033397762 7:140992229-140992251 CTTTGCCCGTAGCTTGTGGTGGG - Intergenic
1035717548 8:1764950-1764972 CTTTTCAGGAAGGTTGTGAGAGG + Intronic
1048010292 8:130450062-130450084 CTTTGTTCCAAGGTTGTTCTGGG - Intergenic
1058435620 9:104960459-104960481 CACTGCACTAAGGTTCTGCTGGG - Intergenic
1060188122 9:121576133-121576155 CTGTGCACGAAGGATGAGTTGGG - Intronic
1188576143 X:31652459-31652481 TTTTGTATGAAGTTTGTGCTAGG - Intronic
1189316036 X:40057229-40057251 CCCTGCATGAAGCTTGTGCTAGG - Exonic
1190494975 X:51020230-51020252 CTTTGGACCAAGGTTTTGCTTGG + Intergenic
1190816631 X:53935410-53935432 CTTTGCAGGAATGATGGGCTGGG - Intergenic
1194124118 X:89992538-89992560 CTTTGCACAAAGGCTTGGCTAGG - Intergenic
1197524750 X:127547625-127547647 CATTGCCCCAAGGTTGTGCAGGG - Intergenic