ID: 1150655406

View in Genome Browser
Species Human (GRCh38)
Location 17:67035953-67035975
Sequence GGTGACCTCCCCCACTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150655406_1150655413 15 Left 1150655406 17:67035953-67035975 CCATCCCAGTGGGGGAGGTCACC No data
Right 1150655413 17:67035991-67036013 ATCGCCAGCCCTTTCATTTGAGG No data
1150655406_1150655415 20 Left 1150655406 17:67035953-67035975 CCATCCCAGTGGGGGAGGTCACC No data
Right 1150655415 17:67035996-67036018 CAGCCCTTTCATTTGAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150655406 Original CRISPR GGTGACCTCCCCCACTGGGA TGG (reversed) Intergenic
No off target data available for this crispr