ID: 1150656388

View in Genome Browser
Species Human (GRCh38)
Location 17:67042489-67042511
Sequence CACCCAGCAAAGCAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150656388_1150656391 -7 Left 1150656388 17:67042489-67042511 CCCAGCTACTGCTTTGCTGGGTG No data
Right 1150656391 17:67042505-67042527 CTGGGTGCCTGGCACTCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150656388 Original CRISPR CACCCAGCAAAGCAGTAGCT GGG (reversed) Intergenic
No off target data available for this crispr