ID: 1150656391

View in Genome Browser
Species Human (GRCh38)
Location 17:67042505-67042527
Sequence CTGGGTGCCTGGCACTCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150656388_1150656391 -7 Left 1150656388 17:67042489-67042511 CCCAGCTACTGCTTTGCTGGGTG No data
Right 1150656391 17:67042505-67042527 CTGGGTGCCTGGCACTCAGTAGG No data
1150656387_1150656391 -6 Left 1150656387 17:67042488-67042510 CCCCAGCTACTGCTTTGCTGGGT No data
Right 1150656391 17:67042505-67042527 CTGGGTGCCTGGCACTCAGTAGG No data
1150656389_1150656391 -8 Left 1150656389 17:67042490-67042512 CCAGCTACTGCTTTGCTGGGTGC No data
Right 1150656391 17:67042505-67042527 CTGGGTGCCTGGCACTCAGTAGG No data
1150656384_1150656391 6 Left 1150656384 17:67042476-67042498 CCTCTTCTGGCTCCCCAGCTACT No data
Right 1150656391 17:67042505-67042527 CTGGGTGCCTGGCACTCAGTAGG No data
1150656383_1150656391 7 Left 1150656383 17:67042475-67042497 CCCTCTTCTGGCTCCCCAGCTAC No data
Right 1150656391 17:67042505-67042527 CTGGGTGCCTGGCACTCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150656391 Original CRISPR CTGGGTGCCTGGCACTCAGT AGG Intergenic
No off target data available for this crispr