ID: 1150662128

View in Genome Browser
Species Human (GRCh38)
Location 17:67091918-67091940
Sequence GCAAATACGCTACAGTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 42}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150662124_1150662128 5 Left 1150662124 17:67091890-67091912 CCCCTCAAATTATCATTTTCTGC 0: 1
1: 0
2: 2
3: 26
4: 335
Right 1150662128 17:67091918-67091940 GCAAATACGCTACAGTTTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 42
1150662125_1150662128 4 Left 1150662125 17:67091891-67091913 CCCTCAAATTATCATTTTCTGCT 0: 1
1: 1
2: 1
3: 47
4: 465
Right 1150662128 17:67091918-67091940 GCAAATACGCTACAGTTTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 42
1150662123_1150662128 6 Left 1150662123 17:67091889-67091911 CCCCCTCAAATTATCATTTTCTG 0: 1
1: 0
2: 1
3: 30
4: 369
Right 1150662128 17:67091918-67091940 GCAAATACGCTACAGTTTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 42
1150662126_1150662128 3 Left 1150662126 17:67091892-67091914 CCTCAAATTATCATTTTCTGCTT 0: 1
1: 0
2: 4
3: 53
4: 637
Right 1150662128 17:67091918-67091940 GCAAATACGCTACAGTTTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150662128 Original CRISPR GCAAATACGCTACAGTTTGG TGG Intronic
909045598 1:70706064-70706086 GCAAAAATGGTAGAGTTTGGTGG + Intergenic
1063847024 10:10141468-10141490 GCAAATAAGTGACAGCTTGGAGG - Intergenic
1064885490 10:20106776-20106798 GCAAATAAGCTACAGTATATAGG - Intronic
1065401318 10:25305212-25305234 GCAAATCTGTTCCAGTTTGGCGG + Intronic
1086945410 11:92839616-92839638 GATGATACACTACAGTTTGGAGG - Intronic
1090241396 11:125184539-125184561 GCAAAGACCCTACTGTGTGGTGG + Intronic
1093981755 12:25483015-25483037 GCAAGTACCCTAAAGTTAGGAGG - Intronic
1094273683 12:28645395-28645417 GCAAGTCTGCTACAGTTTGCTGG + Intergenic
1107428677 13:40318913-40318935 GTAAATAAGATACAGTTTTGAGG - Intergenic
1108691444 13:52862675-52862697 GCAAATAGGCTACAGGGTAGGGG + Intergenic
1110284594 13:73734938-73734960 GGTAATACTCAACAGTTTGGAGG + Intronic
1115434226 14:33355175-33355197 GCAAACAAGCTACGGATTGGTGG - Intronic
1115715816 14:36102068-36102090 GCAAATCTGCTAGAGTGTGGAGG + Intergenic
1124470567 15:29981484-29981506 TCAAAAGCGCTCCAGTTTGGAGG + Intergenic
1126316140 15:47372039-47372061 GCAAATACACTACATTGTAGTGG - Intronic
1126930692 15:53646933-53646955 GGCAATACCCTACAATTTGGGGG - Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1150662128 17:67091918-67091940 GCAAATACGCTACAGTTTGGTGG + Intronic
1158445735 18:57518849-57518871 GCAAGTGCGCTGCATTTTGGAGG - Intergenic
1161671227 19:5611601-5611623 GAAAATACTCGACATTTTGGGGG - Exonic
1161675880 19:5648996-5649018 GAAAATACTCGACATTTTGGGGG + Exonic
1161938021 19:7384012-7384034 GCAAATAAGCTCCACGTTGGAGG + Intronic
926998002 2:18759128-18759150 ACAAATAGGCTACAGATTTGGGG + Intergenic
928591299 2:32818158-32818180 GCATATATGCCACACTTTGGGGG - Intronic
929130657 2:38566325-38566347 GCCACTACTCTACAGTCTGGGGG + Intronic
938691911 2:133799676-133799698 GGAAACACCCTGCAGTTTGGTGG - Intergenic
941434324 2:165449916-165449938 ACTAATACGCTTCAGTTTTGAGG - Intergenic
945737520 2:213618450-213618472 GCAGATACTTTACAGTTTGGGGG - Intronic
1181993313 22:26854857-26854879 GCAAACTCCCTCCAGTTTGGGGG + Intergenic
959582957 3:108000650-108000672 GGAAATACGTTAAAGTTTTGGGG + Intergenic
964669289 3:159207939-159207961 GCAAATACACAATAGTTTGGAGG + Intronic
975597027 4:76057222-76057244 GGAAATACCTTACAGGTTGGAGG + Intronic
979690159 4:123550997-123551019 GCAAATAAACTGCAGTTTGTTGG - Intergenic
983946801 4:173595195-173595217 GCAATAATGCTACAGTTTGGCGG + Intergenic
1001880509 5:175240108-175240130 CCAAATAAGCTACAGTTTCTCGG - Intergenic
1030804250 7:113894824-113894846 TCAAATACTATAGAGTTTGGAGG - Intronic
1031140636 7:117939256-117939278 CCAAATTCGCTACATTTTTGAGG + Intergenic
1033928549 7:146494587-146494609 GCAAATAACCAACAGTTAGGAGG + Intronic
1035776022 8:2189155-2189177 TCATTTACTCTACAGTTTGGGGG - Intergenic
1038378839 8:27072833-27072855 GGAAATACGCTACAATCTTGGGG - Intergenic
1044941584 8:97349142-97349164 GCACATACTGTACAGTCTGGGGG - Intergenic
1051019997 9:12532348-12532370 TCAAAAACCCTAAAGTTTGGAGG + Intergenic
1060429910 9:123542103-123542125 GCAAATTCACTGAAGTTTGGGGG + Intronic
1061547095 9:131310782-131310804 GCAAATCCTCTAAAGCTTGGAGG + Intergenic
1062118247 9:134820652-134820674 TCCAATGAGCTACAGTTTGGGGG - Intronic
1191928613 X:66343907-66343929 GCAGATCTGCTACAGTTTGCTGG + Intergenic
1193748603 X:85314431-85314453 GCAAATACGCTACATTCTGCAGG - Exonic