ID: 1150664945

View in Genome Browser
Species Human (GRCh38)
Location 17:67125636-67125658
Sequence CAATTTAATCAGAGTGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150664941_1150664945 13 Left 1150664941 17:67125600-67125622 CCAGGGACAACTGCTTAGCATGT 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1150664945 17:67125636-67125658 CAATTTAATCAGAGTGTGGCAGG 0: 1
1: 0
2: 1
3: 12
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150664945 Original CRISPR CAATTTAATCAGAGTGTGGC AGG Intronic
903866246 1:26400433-26400455 CAAATGCATCAGACTGTGGCTGG - Intergenic
907980842 1:59479254-59479276 AAATTTGGTCAGAGTGTGGGGGG + Intronic
909678960 1:78269753-78269775 CAATTTAATCAAAGTTTTCCAGG + Intergenic
909858592 1:80574258-80574280 GAATTTAATCAGAGTGTTTAGGG + Intergenic
909916313 1:81324016-81324038 GAATTTAAGCAGAGTGAGGCAGG + Intronic
910080001 1:83330237-83330259 CAATTAAATCACAATGTGACAGG - Intergenic
911884061 1:103275200-103275222 CAATCTGATCAGATAGTGGCAGG - Intergenic
916617231 1:166454459-166454481 CAATTCAATGAGATTGGGGCAGG + Intergenic
916660433 1:166918511-166918533 CAATCTAATCAGAGTGCAGAGGG + Exonic
917137380 1:171800726-171800748 CAATTAAATCAGAGTCTGTGGGG - Intronic
917499153 1:175570304-175570326 CATTTTAATCAGAGTTTGAGGGG - Intronic
917728103 1:177846969-177846991 GATTTTAAGCAGTGTGTGGCTGG - Intergenic
918153238 1:181817311-181817333 CAGTGGAATCAAAGTGTGGCAGG + Intergenic
920570780 1:207015715-207015737 CCACTAAAGCAGAGTGTGGCAGG + Intronic
920806156 1:209235828-209235850 CAATTTAAGCTGGTTGTGGCTGG + Intergenic
921715257 1:218411291-218411313 AAATTTCATCAGAGCTTGGCTGG + Intronic
922150546 1:222999614-222999636 CAAATTGTTCACAGTGTGGCAGG - Intronic
923985201 1:239374003-239374025 CAATATAATGAGATTGTGGTAGG + Intergenic
1064340079 10:14477806-14477828 CAATTTAATCAGAGCATTCCAGG - Intergenic
1067748197 10:48952348-48952370 CACTGTAATCAGAGGGAGGCTGG - Intronic
1067821938 10:49538556-49538578 CAAATTGATAAGAGTGTGGGCGG - Intronic
1068753061 10:60618778-60618800 CATTTGGATCAGAGTTTGGCTGG - Intronic
1072942893 10:99783159-99783181 CAATTTAATCCGTGTGAGGAAGG + Intronic
1074643683 10:115418789-115418811 CAATATATTCAGAATGTGGAAGG + Intronic
1085733100 11:79016020-79016042 CAAGGTACTGAGAGTGTGGCTGG + Intronic
1088921993 11:114266450-114266472 CAAATGAATCACAGTGAGGCTGG - Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1093140615 12:15506564-15506586 CACCTTATTCAGAGGGTGGCAGG + Intronic
1094579469 12:31721143-31721165 CAATCAAATCAGACTGTCGCAGG - Intronic
1097568684 12:61303568-61303590 CAATTTAATCCAAGTGTGTCAGG + Intergenic
1099518661 12:83630775-83630797 CAATTGAGTCAGAATGGGGCTGG - Intergenic
1100976065 12:100123774-100123796 CAATTTACACAGAGTTTGTCTGG + Intronic
1101956859 12:109219444-109219466 CAATTTAATCAGAGTTTCTAGGG + Intronic
1102821918 12:115915803-115915825 CAATTAAATCAGAATGTCGATGG + Intergenic
1104800585 12:131552899-131552921 CAGTGCAATCAGAGTGAGGCTGG + Intergenic
1108587102 13:51879791-51879813 TAATTTCAACAGAATGTGGCAGG + Intergenic
1108792239 13:53984344-53984366 TTATGAAATCAGAGTGTGGCAGG - Intergenic
1111415732 13:87941255-87941277 GAATTTAATTAGAGTGTGCTGGG - Intergenic
1112038133 13:95516834-95516856 AAATTTAATCAGAATGTGTGTGG + Intronic
1112852379 13:103722675-103722697 CAGTTTAATCAGAGAGTGCCAGG - Intergenic
1120587653 14:86334081-86334103 CAATTTAATCATATTTTGGGGGG - Intergenic
1121276359 14:92670718-92670740 CAATTTCCTCACAGTGTGGTTGG + Intronic
1122289556 14:100672912-100672934 GAATTTCATCAGAATGGGGCTGG - Intergenic
1122292798 14:100688493-100688515 CAGTCTAATTGGAGTGTGGCCGG + Intergenic
1125575610 15:40753662-40753684 CAATTGAAGCTGAATGTGGCTGG - Intronic
1126054512 15:44717081-44717103 CAATTTACTAACAGTGTGACTGG - Intronic
1129148735 15:73673309-73673331 TAATTCAATCCAAGTGTGGCAGG - Intergenic
1130665046 15:85862406-85862428 CAATTAAATCAGAGTCTTGAGGG + Intergenic
1131652952 15:94422035-94422057 CATTTTAAACTGAGAGTGGCTGG + Intronic
1133341400 16:5038736-5038758 CAATTTAACCAGATTGGGGGTGG + Intronic
1135159175 16:20078370-20078392 CACTTTACTCAGAGTTTGGAAGG + Intergenic
1138138701 16:54547486-54547508 CATTTCAATCCGAGAGTGGCTGG - Intergenic
1138223912 16:55276371-55276393 GAATTCAATCACAGTGTGCCAGG + Intergenic
1139254851 16:65531046-65531068 CCACTAAACCAGAGTGTGGCAGG - Intergenic
1140304183 16:73787321-73787343 CATTTTAATCACAGTGTGTCTGG - Intergenic
1140741814 16:77948163-77948185 CAATTCCAACAGAGTGTGGGAGG - Intronic
1144702655 17:17349124-17349146 CAATGTTTTCAGGGTGTGGCTGG - Intergenic
1149296418 17:55265718-55265740 CAATTTCATCAGCGCGGGGCCGG - Intronic
1149478547 17:56983715-56983737 CAATTTTATCAGAGTTAGGTTGG + Intronic
1150664945 17:67125636-67125658 CAATTTAATCAGAGTGTGGCAGG + Intronic
1157890697 18:51414248-51414270 CAGTTCAATCAGATTGTGGCAGG + Intergenic
1158494625 18:57943242-57943264 GAATTCAGTCTGAGTGTGGCTGG + Intergenic
1159883810 18:73885210-73885232 AAAATTATTCAGAATGTGGCTGG + Intergenic
1160128189 18:76198800-76198822 CAATTTAATTATAATGTGACTGG - Intergenic
1160235150 18:77079777-77079799 GAATTTATTCTGAGTGTGGAAGG - Intronic
1160729621 19:635208-635230 CAATTTGAGCAGAGTGGGGCTGG + Intergenic
1167978286 19:53251052-53251074 CAATTGAATCAGTGTGTTTCTGG - Intronic
935075229 2:99735973-99735995 TAATTTAATCATACTGTGGTTGG + Intronic
936443298 2:112574994-112575016 CATTTTAAGCAGATTGTGGCCGG + Exonic
938321696 2:130370530-130370552 CAAGAGAATCAGAGTGTGCCTGG - Intronic
938565717 2:132516601-132516623 GAAGGTTATCAGAGTGTGGCCGG - Intronic
939533531 2:143395202-143395224 GAATTAAATCAGATTGTGGGAGG + Intronic
944526867 2:200628443-200628465 CAATGACAGCAGAGTGTGGCGGG - Intronic
1168905904 20:1403573-1403595 CAGTATCATCAGGGTGTGGCTGG + Intergenic
1169378820 20:5088897-5088919 CAAGTTCATCTGAGTGTGGGTGG + Intronic
1170272276 20:14540591-14540613 CATTTCAATCAGAGACTGGCAGG - Intronic
1170476825 20:16723206-16723228 GAATTCAGTCAGACTGTGGCAGG - Intergenic
1170647213 20:18208326-18208348 TAATTCAATCTGTGTGTGGCTGG + Intergenic
1175608140 20:60328296-60328318 GAATTCAGCCAGAGTGTGGCAGG + Intergenic
1177232705 21:18343073-18343095 AGATTAAATCAGAGTGGGGCAGG + Intronic
1179184429 21:39073878-39073900 TAATTTAATTAGTGTCTGGCTGG + Intergenic
1182034385 22:27186222-27186244 CAACTTACGCAAAGTGTGGCAGG + Intergenic
1182362020 22:29752283-29752305 CATTTGGGTCAGAGTGTGGCTGG - Intronic
1183126648 22:35788540-35788562 CAGTTTAATGATAGTTTGGCTGG + Intronic
1183832706 22:40427138-40427160 CACATTTATCAGACTGTGGCTGG + Intronic
951281357 3:20753685-20753707 CAATATAATCAGGATGTGTCAGG - Intergenic
952217835 3:31295298-31295320 CAATTAAATCAGGAGGTGGCTGG + Intergenic
953389071 3:42524161-42524183 CAAATGAATCAGATTGTGGGTGG + Intronic
953742549 3:45550026-45550048 CATTTTGAGCAGAGTGTGGCTGG + Intergenic
954002135 3:47566111-47566133 CAATCTTTTCAGAGTGTGGCTGG + Intronic
959155398 3:102660647-102660669 TAATCACATCAGAGTGTGGCAGG + Intergenic
959632058 3:108517762-108517784 GAATTTAATCAGAAGGTGGCCGG - Intronic
961590211 3:127973933-127973955 CAATTTCTCCAGGGTGTGGCTGG - Intronic
962354967 3:134685999-134686021 CAAGTCAATCAGCCTGTGGCAGG + Intronic
963031596 3:140983645-140983667 CAATTTAATCAAAGTAAGGAGGG + Intergenic
964280747 3:155061808-155061830 GAATTAACTGAGAGTGTGGCAGG - Intronic
966377517 3:179312090-179312112 CAATTTAGGCTGAGCGTGGCGGG - Intergenic
971866597 4:32180106-32180128 CAATTCAAACAGAGGGAGGCAGG + Intergenic
972086993 4:35230186-35230208 AACTTAAACCAGAGTGTGGCAGG - Intergenic
976049671 4:80996856-80996878 TTATTTAATCAAAGTGTGGTAGG - Intergenic
976536997 4:86229094-86229116 AAATTTCAACAGAGTGTTGCTGG - Intronic
976819594 4:89190433-89190455 CAGTTTATTCATAGTGTGGTTGG + Intergenic
977404062 4:96574043-96574065 CAATTCAAACAGAGGCTGGCAGG + Intergenic
980174519 4:129328519-129328541 CAATCTGATCAAAGTATGGCTGG + Intergenic
980719335 4:136673162-136673184 CAATGCAATCATAGTGTGGAAGG + Intergenic
981759631 4:148179628-148179650 CAATTTAATGAGAGTTTTGAAGG + Intronic
983358073 4:166690589-166690611 CAATTCAATCAGAGTATTTCAGG + Intergenic
989111133 5:37907523-37907545 ACATTTACTCAGAGCGTGGCTGG + Intergenic
990867884 5:60399917-60399939 CAATTGAAACAGACTTTGGCTGG - Intronic
991480816 5:67077295-67077317 CAATTAAATCAGAATGGGGAGGG - Intronic
991502771 5:67293679-67293701 CAATATATTCAGACAGTGGCAGG + Intergenic
992949246 5:81840550-81840572 CAATCTAGTAAGAGTGTTGCTGG + Intergenic
992955803 5:81907028-81907050 CTAGTTAATCTGAGTGAGGCAGG + Intergenic
993312372 5:86350727-86350749 AAATTTAATCAGAAAGTGGAGGG - Intergenic
1000813723 5:165893479-165893501 AAATTTACTCAGAGTCCGGCTGG - Intergenic
1000822256 5:165999115-165999137 CAATGTAATGAGATTGTGCCAGG - Intergenic
1002373275 5:178771198-178771220 CAATTTAAACAGACAGTGGGAGG - Intergenic
1004279890 6:14271592-14271614 CCATTTAATCACACTGTGACCGG - Intergenic
1005258618 6:24032329-24032351 GAAATGAATCAGAGTGTGGCAGG - Intergenic
1005465011 6:26104436-26104458 AAATTTTGTCACAGTGTGGCCGG - Intergenic
1005686006 6:28253652-28253674 CAATTAAATCAGAATGTCACAGG + Intergenic
1006666585 6:35699029-35699051 CAATTTGAACAGAATTTGGCAGG + Intronic
1009530033 6:64801929-64801951 CAACCTAATCAGAGTGTGGCAGG - Intronic
1010767300 6:79790738-79790760 ATATTTAATAAGAGTGTGGATGG + Intergenic
1011184803 6:84662392-84662414 CTATTTAAACTGAGTGTGGTAGG + Intergenic
1011333897 6:86238719-86238741 CAATTTCATCATAGTGTTGATGG - Intergenic
1011621931 6:89251245-89251267 CAATAAAATCAGAATGGGGCTGG + Intergenic
1012300805 6:97585613-97585635 CAATTTAATCAGAATCTGTAGGG - Intergenic
1016072557 6:139757371-139757393 CAATTGAATCAGAATATGGAGGG - Intergenic
1020975771 7:15004119-15004141 CAATTTTATAAGAGGGAGGCAGG - Intergenic
1021027766 7:15689027-15689049 GAATTTAACCAGTGTGTTGCAGG + Intergenic
1027297764 7:76795516-76795538 CAATTAAATCACAATGTGACAGG - Intergenic
1027370512 7:77504869-77504891 AAAATTAATTAGAGTGAGGCCGG - Intergenic
1030548544 7:110929978-110930000 CAAATTTATCAGAGTTTGGGAGG + Intronic
1031522590 7:122784762-122784784 GAATTTTATCAGAATGTGTCTGG + Intronic
1032727837 7:134607602-134607624 GAGTTAAATCAGAGTGGGGCAGG - Intergenic
1034073856 7:148213529-148213551 CAAATGAATCACAGTGGGGCAGG - Intronic
1039593576 8:38770662-38770684 GACTTTAATTAAAGTGTGGCGGG + Intronic
1041278921 8:56191695-56191717 CATTTAATTCAGAGTTTGGCAGG + Intronic
1042023202 8:64393436-64393458 AAATTTAATCAGGGTGTTGATGG - Intergenic
1044564112 8:93645305-93645327 CAACTTAATCACAGTGTCCCAGG - Intergenic
1045311470 8:101007126-101007148 GAATTTATTCAGAGTGAGGGAGG + Intergenic
1048181197 8:132196103-132196125 CAATTTCATCAAAATGTGGCAGG + Intronic
1048785900 8:138050213-138050235 CAATTAAATCAGAGCTTGGGTGG + Intergenic
1055492038 9:76815172-76815194 CATTTTTATCAGAGTGTTTCAGG + Intronic
1058804474 9:108577698-108577720 TAATTTAATCAGTCTGTGCCAGG + Intergenic
1059116828 9:111607381-111607403 CAAATTAATAAGGCTGTGGCGGG - Intergenic
1060359741 9:122943363-122943385 CAATTAAAAGAAAGTGTGGCCGG - Intronic
1186979481 X:14943976-14943998 CATTTAAATCAGAGTCTGGTGGG - Intergenic
1189227776 X:39427664-39427686 AAAAATAATCAGAGTGTGGGGGG + Intergenic
1189574890 X:42341449-42341471 CAATTTCTTCATAGTGTCGCTGG + Intergenic
1194296859 X:92136748-92136770 ACTTTTAATCAGAGTGTGACGGG + Intronic
1194624982 X:96216575-96216597 CAGTTTCTTCAGAGTGTGGATGG - Intergenic
1198001655 X:132445235-132445257 CAATTCAAGCAGTGTATGGCAGG - Intronic