ID: 1150665419

View in Genome Browser
Species Human (GRCh38)
Location 17:67131376-67131398
Sequence CTTCACAAAAAGCTGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150665415_1150665419 30 Left 1150665415 17:67131323-67131345 CCTTGACCGCAATGAACAGAATT 0: 1
1: 0
2: 1
3: 5
4: 107
Right 1150665419 17:67131376-67131398 CTTCACAAAAAGCTGGAGCTTGG 0: 1
1: 0
2: 1
3: 12
4: 194
1150665416_1150665419 24 Left 1150665416 17:67131329-67131351 CCGCAATGAACAGAATTTGAAGT 0: 1
1: 0
2: 3
3: 18
4: 244
Right 1150665419 17:67131376-67131398 CTTCACAAAAAGCTGGAGCTTGG 0: 1
1: 0
2: 1
3: 12
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150665419 Original CRISPR CTTCACAAAAAGCTGGAGCT TGG Intronic
900755335 1:4430593-4430615 CTCCACTAGAAGCTGGAGGTGGG + Intergenic
900932097 1:5743969-5743991 CTTCACTCAGAGCTGGATCTGGG - Intergenic
901257371 1:7841755-7841777 CTCACCAAAAAGCAGGAGCTGGG + Intronic
901406414 1:9049835-9049857 CTTTTCAAAAAGATGGTGCTGGG + Intronic
903542472 1:24104802-24104824 CTTCCCAAAGTGCTGGAGGTGGG + Intronic
904090638 1:27942598-27942620 CTTCCCAAGTAGCTGTAGCTGGG + Intronic
907733365 1:57088616-57088638 AATCCCAAAAAGCTGGAGGTGGG - Intronic
908330064 1:63062635-63062657 CTTCACACAATGCTGTAGTTTGG - Intergenic
910220129 1:84881250-84881272 CTTCAGAATCAGCTGGACCTGGG + Intronic
913527472 1:119707866-119707888 CTTCCTGAAAAGGTGGAGCTTGG - Intronic
913553158 1:119936569-119936591 CTTCACAGCAGGCTGGGGCTGGG - Intronic
915103982 1:153520986-153521008 CTGCACAAAAAGCTCATGCTAGG - Intergenic
917652841 1:177095941-177095963 CTTCAGAAAACACTGGGGCTAGG - Intronic
917690898 1:177467737-177467759 CATCACAAAAAGATTTAGCTTGG - Intergenic
918214159 1:182378627-182378649 CTTTACAAAATGCTGTATCTTGG + Intergenic
919738096 1:200966061-200966083 CTTCAAAAAGAGCTGCAGCCAGG - Intergenic
921157811 1:212452014-212452036 CTTGACAACAGGCTGGAGTTTGG + Intergenic
922342707 1:224670432-224670454 CTCCACAAAAGGATGGGGCTGGG - Intronic
923511297 1:234656169-234656191 CTTCAGGAAAAACCGGAGCTGGG - Intergenic
924417060 1:243867012-243867034 ATTTACAAAAAGCTGGGACTGGG - Intergenic
1063345372 10:5307054-5307076 CTTCCCAAGCAGCTGGGGCTAGG - Intergenic
1063585085 10:7345087-7345109 CTTCACAGAGAGATGGAGCCAGG + Intronic
1065852516 10:29802622-29802644 CTTAATGAAAATCTGGAGCTAGG + Intergenic
1067368618 10:45661019-45661041 CTTCACAAAAAACAGGATGTAGG + Intronic
1067401229 10:45975645-45975667 CCTCACAAACACCAGGAGCTTGG + Intronic
1067869581 10:49945223-49945245 CCTCACAAACACCAGGAGCTTGG + Intronic
1070723664 10:78773601-78773623 CTCCAGGAAGAGCTGGAGCTTGG - Intergenic
1073183260 10:101599217-101599239 TTTCACAATAAGCTGCTGCTCGG + Intronic
1073277835 10:102328085-102328107 CGTCAAAAATAGATGGAGCTAGG - Intronic
1073750076 10:106515370-106515392 CTGCACAAGAATCTGGAACTTGG + Intergenic
1075099264 10:119494444-119494466 CTTCACACACAGCTGGAGCCAGG - Intergenic
1076549001 10:131265484-131265506 CTTCACAAGGGCCTGGAGCTGGG - Intronic
1076678097 10:132158424-132158446 CCTCACAGAAAGCTGAAGCTGGG - Intronic
1078579074 11:12525003-12525025 CTTCCCAAATAGCTGGCTCTAGG - Intronic
1079081393 11:17415723-17415745 CTGCACAAACAGCTGGGGCAAGG + Intronic
1079686485 11:23365269-23365291 CTTCAGAATAAGCTGGAAGTTGG - Intergenic
1079808917 11:24970841-24970863 GACCATAAAAAGCTGGAGCTTGG - Intronic
1080734653 11:35001299-35001321 CTTCAAAAAAAGCAGGGGCCAGG - Intronic
1082120447 11:48374187-48374209 CCTCCCAAATAGCTGGAGCTGGG + Intergenic
1082253847 11:50011039-50011061 CCTCCCAAATAGCTGGAGCAGGG - Intergenic
1083868483 11:65471821-65471843 CTTCCCATAATCCTGGAGCTGGG - Intergenic
1089272885 11:117314419-117314441 CTTCTCAGACAGCTGGATCTGGG - Intronic
1092492355 12:8956865-8956887 CTTCACATGAAGCTGGTGCCTGG + Intronic
1094336134 12:29356332-29356354 CTTTAGACAAAGTTGGAGCTTGG - Intronic
1096188970 12:49602481-49602503 CTCCCCACAAACCTGGAGCTAGG + Intronic
1096199481 12:49671474-49671496 CTTCTGAGAATGCTGGAGCTTGG - Intronic
1101763581 12:107678845-107678867 CTTCAGACATAGCTGGATCTAGG - Intergenic
1103449823 12:121020789-121020811 CTTCACGAAGACCTGGATCTCGG + Exonic
1103530684 12:121599406-121599428 CATCACAAAAAACTGGAAATAGG + Intergenic
1104222980 12:126803739-126803761 CTTCAGGAACAGCTGGAGCCTGG - Intergenic
1105241904 13:18615536-18615558 AATTACAAAAAACTGGAGCTAGG - Intergenic
1107076965 13:36332380-36332402 CCTCCCAAGGAGCTGGAGCTAGG - Intronic
1119097045 14:71842696-71842718 CATCAAAAAAAGCTGGAGGCCGG - Intergenic
1120814875 14:88845583-88845605 CTTCATAAAAAGCTGGTGAGGGG + Intronic
1122229091 14:100296266-100296288 CTTCAAAAAAAACATGAGCTAGG + Intronic
1123118062 14:105903647-105903669 CTTCACAAAAAGCCCGAGTGTGG + Intergenic
1125625592 15:41106511-41106533 CCTCCCAAATAGCTGGGGCTGGG - Intronic
1126142766 15:45451193-45451215 CTTCACAAAAGGTTAGTGCTGGG - Intergenic
1127171677 15:56309882-56309904 AATCCCAAAAAGCTGGAGGTGGG + Intronic
1128653128 15:69434901-69434923 CTGCACCACGAGCTGGAGCTGGG - Intronic
1128721615 15:69954636-69954658 CTTCACAAACAGCAGAAGGTGGG + Intergenic
1130801570 15:87269200-87269222 CTCCACAAATAGCTGGAGTATGG + Intergenic
1131735511 15:95327100-95327122 CTGCACAAAAGGATGGGGCTTGG + Intergenic
1132421181 15:101671184-101671206 CTTCACAAAATGCTGGCATTGGG - Intronic
1132816126 16:1827431-1827453 CTGCACCACGAGCTGGAGCTGGG + Exonic
1134678665 16:16108523-16108545 CCTCCCAAAGAGCTGGTGCTGGG + Intronic
1137390242 16:48075262-48075284 CTTCCCAAAACGAGGGAGCTGGG + Intergenic
1138683388 16:58703835-58703857 CTTAAAAAAAAGGGGGAGCTGGG - Intergenic
1141256608 16:82408389-82408411 CTTCACTGAAATCTGGTGCTGGG - Intergenic
1146606950 17:34268731-34268753 CTTCACCAATTTCTGGAGCTGGG + Intergenic
1150665419 17:67131376-67131398 CTTCACAAAAAGCTGGAGCTTGG + Intronic
1152868068 17:82735922-82735944 CTTCACAGAACGCTTGAGCCGGG - Intronic
1153234926 18:2976909-2976931 AATCACAAACAGCTGGGGCTGGG + Intronic
1154267545 18:12892190-12892212 CTTAACAAAAAGGTGAAGCAGGG - Intronic
1154447047 18:14444341-14444363 AATTACAAAAAACTGGAGCTAGG + Intergenic
1155706587 18:28823555-28823577 CTTTACAAAAAACTGCAGCTAGG - Intergenic
1156657585 18:39307531-39307553 CCTCACCAGAAGCTGGTGCTGGG - Intergenic
1156742374 18:40347569-40347591 ATTCAGAGATAGCTGGAGCTGGG - Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1163132675 19:15285441-15285463 CCTCCCAAGTAGCTGGAGCTGGG - Intronic
1165392686 19:35547484-35547506 CTTCACTAAAACCTGGAGTGAGG - Exonic
1165930247 19:39353134-39353156 AGCCACAAAATGCTGGAGCTGGG + Intronic
1166560417 19:43729154-43729176 CTGCACAAAACCCTGGAGGTGGG + Exonic
925820766 2:7797526-7797548 CATCAGAAAAAGGGGGAGCTTGG + Intergenic
926851514 2:17203292-17203314 CTTCACAAAAAGGATGAGTTTGG - Intergenic
927041582 2:19235986-19236008 CTTCACAAACACCTGGGGCCAGG - Intergenic
927317317 2:21699126-21699148 CTGCACACAAACCTGCAGCTTGG + Intergenic
928794107 2:34995775-34995797 CTTCAGAAAAAGAAAGAGCTGGG + Intergenic
929273339 2:39998737-39998759 CATCACAAAGAGCTGCAGCTTGG - Intergenic
930016182 2:46972067-46972089 CTTCAGGCAAAGCTGGATCTAGG + Intronic
931089410 2:58869369-58869391 CTTCCCAAACATGTGGAGCTTGG - Intergenic
931097505 2:58957824-58957846 TTTCATAAAATGCTGGAGCCTGG + Intergenic
931598852 2:63981735-63981757 CTTCACAAAAACATGGGGATTGG - Exonic
932738719 2:74275241-74275263 CTTCACCAAATGCATGAGCTTGG - Intronic
938099312 2:128487383-128487405 CTTCTCAACAACCTGGAGGTGGG - Intergenic
939965804 2:148609242-148609264 CTTCACTTAATGCTGAAGCTAGG - Intergenic
942519564 2:176789342-176789364 CAGCACAACAAGCTGGAGCCAGG + Intergenic
943798088 2:192023543-192023565 CTTCAAAATAGGCTGGAGGTAGG + Intronic
944005434 2:194898848-194898870 CTTCACCAGAAATTGGAGCTTGG - Intergenic
945005583 2:205401827-205401849 CTTCACAACTAAATGGAGCTTGG + Intronic
946140514 2:217686749-217686771 CTTCACAAAGATCTGGAGGTTGG - Intronic
947425590 2:229980459-229980481 TTCCACAAAAACCTGGAGATGGG + Intronic
1168857476 20:1018888-1018910 CTTCACAAATGCCTGGACCTTGG + Intergenic
1168999112 20:2154129-2154151 CCACAGAAAAAGCTAGAGCTTGG + Intronic
1171002951 20:21433328-21433350 GATTCCAAAAAGCTGGAGCTGGG + Intergenic
1171389895 20:24794653-24794675 CTTCACTCAAGGCTGGAGCTGGG - Intergenic
1173455634 20:43199154-43199176 CTTCAGGCAAAGCTGGATCTAGG + Intergenic
1175132515 20:56800341-56800363 CTTCACGAGAAGTTGGAGCAAGG - Intergenic
1175481702 20:59315854-59315876 CTTCAAGAAAAGCTGGAAATCGG + Intronic
1175547603 20:59788647-59788669 CATCAGAAAGAGCTGGAGCCAGG - Intronic
1176793823 21:13354444-13354466 CTTCACTGAAAGCAGCAGCTTGG - Intergenic
1176939506 21:14906868-14906890 ATTCTCAAAAAGCTGGATATAGG - Intergenic
1176997552 21:15574387-15574409 CTTTTCAAAGAGCTGGTGCTTGG - Intergenic
1177368152 21:20166089-20166111 CTTCTAGAAAATCTGGAGCTGGG + Intergenic
1178925133 21:36768417-36768439 CTTTACAAATGGCTGGAACTCGG + Intronic
1179511173 21:41874876-41874898 CCTTACATAAAACTGGAGCTCGG - Intronic
1182025400 22:27114401-27114423 CTTCATTAAAAAGTGGAGCTGGG + Intergenic
1183918001 22:41138666-41138688 CATCATAAAAAGGTAGAGCTTGG + Intronic
1184723058 22:46326733-46326755 CTTCACTAAAACCTGGAGCAAGG - Intronic
1185298160 22:50064279-50064301 CTTCACAAAGAGCAGGTGCCAGG + Intronic
950842159 3:15978045-15978067 GTTCACACAATGATGGAGCTTGG - Intergenic
951694642 3:25433585-25433607 CCTCTTAAAAAGTTGGAGCTGGG + Intronic
953113045 3:39962189-39962211 CTTCATAACAATCTGGAGATAGG - Intronic
953557396 3:43957329-43957351 TTTCACAACAAGCTGGGGATTGG - Intergenic
953919185 3:46940218-46940240 CCTCCCAAAAATCTGGAGCCTGG - Intronic
953979682 3:47407387-47407409 CTTCACAAAAAGAGGGAACCAGG - Intronic
955709724 3:61765672-61765694 CTTGACAAAAAGCTGGATCACGG - Intronic
956181278 3:66519995-66520017 CTTCACAAAATCCTTGAGTTGGG + Intergenic
956803001 3:72779903-72779925 TTTCACACAAACCTGGAGCAAGG + Intronic
956906817 3:73774487-73774509 CTTCTCAAAGGGCTGGAGTTAGG + Intergenic
958011809 3:87888762-87888784 CTTTACAAAAACCTTGAGGTAGG - Intergenic
963233968 3:142937503-142937525 CTTCAAGAATAGCTGGATCTAGG - Intergenic
963597422 3:147346051-147346073 CTTAACATAAAGATGGAGATGGG + Intergenic
965193638 3:165564568-165564590 CAGCACAAAAATCTGGACCTAGG - Intergenic
968252392 3:197232438-197232460 TTTTAGAAAAAGCTGGAACTGGG + Intronic
968321795 3:197776035-197776057 TTTCACATAAAGCTGGGGGTGGG + Intronic
968535174 4:1122062-1122084 CTTGACAAGTGGCTGGAGCTAGG + Intergenic
972089486 4:35263216-35263238 CTTAACAAAACCCTGGAGATTGG + Intergenic
980911118 4:138995416-138995438 CTTTAGGAAGAGCTGGAGCTGGG - Intergenic
980968346 4:139545536-139545558 CTTTACAAAAAGGTGGGGTTGGG + Intronic
983091619 4:163510183-163510205 CTTCATAAAAAGTTGGAGAATGG - Intronic
984575332 4:181441277-181441299 CTCCACAACAACTTGGAGCTGGG + Intergenic
990254548 5:53953128-53953150 CATTACTAAAAGCTGCAGCTGGG + Intronic
990420455 5:55626947-55626969 CCTCAGAAACATCTGGAGCTAGG + Intronic
991203911 5:64027362-64027384 CTTTAAGAAAAGATGGAGCTTGG + Intergenic
992884206 5:81141579-81141601 CTTCAAAAACAGCAAGAGCTTGG + Intronic
994885658 5:105558100-105558122 CCTAACAAAAATCTGGACCTGGG + Intergenic
994959570 5:106581310-106581332 CTTCACAAAATGTTGGAGTTAGG - Intergenic
996946694 5:129078968-129078990 CTTCATAAACTGCTGGAGCCAGG + Intergenic
997491308 5:134278892-134278914 ATTGAAAGAAAGCTGGAGCTGGG - Intergenic
998572313 5:143273270-143273292 CTTCCAAAAAAGCTGAAGCGGGG - Intergenic
999232045 5:150067264-150067286 CCTCACAAGAAGCTGGAGGCAGG - Intronic
999563077 5:152826347-152826369 CTGCACAAAAGGCAGGTGCTCGG - Intergenic
1001487294 5:172128724-172128746 CTTCACAACAAGCAGGGGCCAGG - Intronic
1003455623 6:6279084-6279106 CTTTCCTAAAAGCTGGAACTGGG + Intronic
1004252982 6:14037359-14037381 GTTGACTAAAACCTGGAGCTGGG - Intergenic
1004512589 6:16294913-16294935 CTACAGAAAGTGCTGGAGCTGGG + Intronic
1006084588 6:31586999-31587021 CATCCCAGAAAGGTGGAGCTGGG - Intronic
1007967395 6:46015480-46015502 CTTCACAAAGAGCTCGATCTCGG + Intronic
1008754471 6:54777741-54777763 CTACACAAAAAGATGGACCATGG - Intergenic
1009871622 6:69459682-69459704 CTTTACAAAAACTTGGAGATGGG - Intergenic
1010287102 6:74091932-74091954 GTTCAGTAAAAGCTGGAGCCAGG + Intergenic
1010621538 6:78082873-78082895 TTTCACTAAAAGCTGGAAATTGG + Intergenic
1014550549 6:122785416-122785438 CTTCCCAAAGTGCTGGTGCTGGG - Intergenic
1014632025 6:123800353-123800375 CTACACCAAAAGCTCAAGCTTGG - Intergenic
1017489916 6:154935906-154935928 TTTCACCAAAAGTTGGGGCTGGG - Intronic
1017732280 6:157327310-157327332 GTTCAAAACAAGCTAGAGCTAGG - Intergenic
1017904865 6:158751116-158751138 TTTCACAAAAAGCTTAACCTAGG + Intronic
1019208323 6:170382118-170382140 CTACAAAAAAAACTAGAGCTAGG + Intronic
1020803182 7:12756954-12756976 CTTCACGAAAAGATGGAGAAAGG - Intergenic
1020914785 7:14179122-14179144 CTTAACATAAAGGTGGAGGTTGG + Intronic
1022956840 7:35389037-35389059 CACCACAGAAAGGTGGAGCTGGG + Intergenic
1025971785 7:66333583-66333605 ATTCACAAGAGACTGGAGCTGGG - Intronic
1027730653 7:81867904-81867926 ATTCACAAATACCTGGAGTTGGG + Intergenic
1028743452 7:94301877-94301899 CTGCCCAAAAATCTGGAACTGGG - Intergenic
1029835690 7:103307186-103307208 ATTTTTAAAAAGCTGGAGCTGGG - Intronic
1030329015 7:108253289-108253311 CTCCACCAGAAGCTGGATCTAGG + Intronic
1032724880 7:134581455-134581477 CTTCATAAAAAGCTTGGGTTTGG + Intergenic
1035061316 7:156071632-156071654 CTTCACAGAAAGCTGGTGGCAGG - Intergenic
1035232555 7:157474972-157474994 CCTTCCAGAAAGCTGGAGCTTGG + Intergenic
1037672893 8:21030225-21030247 CATATCAGAAAGCTGGAGCTGGG - Intergenic
1038394811 8:27238937-27238959 CTTAACAAAAACCTGGGGTTGGG - Intronic
1040021260 8:42743343-42743365 CCTAACAAAAAGATTGAGCTGGG - Intergenic
1042391903 8:68245777-68245799 CTTCATAAAAGGCAGTAGCTAGG + Intergenic
1042527268 8:69776401-69776423 CTTCAAAAAAAGATTGGGCTGGG + Intronic
1046662703 8:116965637-116965659 ATTCAGAAGATGCTGGAGCTTGG - Intronic
1046934356 8:119872402-119872424 CCTCACAAAACCCTGGAGTTTGG - Intergenic
1047947069 8:129891058-129891080 TTCCACAAGAAGCTAGAGCTTGG - Intronic
1047963485 8:130028021-130028043 ACTCACAGAATGCTGGAGCTGGG - Intergenic
1048549335 8:135419527-135419549 CTTTGCAATCAGCTGGAGCTAGG + Intergenic
1050365137 9:4867170-4867192 CTTCAGGTAAAGCTGGATCTAGG + Intronic
1051073698 9:13205006-13205028 GTACACAATAAGCTGGCGCTAGG + Intronic
1052814809 9:33093773-33093795 CTTCAAAATAACCTGGAACTGGG + Intergenic
1053466795 9:38314503-38314525 CTTCATCAAAAGCTAGAGTTGGG - Intergenic
1055442151 9:76347183-76347205 CTACACAGAAAGATGCAGCTTGG - Intronic
1058363859 9:104184161-104184183 CTTCATATAAATCTGGAGGTGGG + Intergenic
1059784658 9:117567785-117567807 CTTCACAAAGATCTGGAGGTTGG + Intergenic
1059879452 9:118673994-118674016 CTGCACAGAGACCTGGAGCTAGG + Intergenic
1060481293 9:124018030-124018052 ACACACAAAAAGCTGGGGCTGGG - Intronic
1062364169 9:136201153-136201175 CTTCACCATCACCTGGAGCTGGG + Intronic
1062530244 9:136996511-136996533 CTTGACAAACAGCTGGAGCTTGG + Exonic
1189996974 X:46648210-46648232 CTCCACAGAAAGTTAGAGCTGGG + Intronic
1195560963 X:106283149-106283171 TTTCACAAGAAGCAGGTGCTAGG - Intergenic
1195671124 X:107470954-107470976 CTACACAACAAACTTGAGCTTGG - Intergenic
1196262343 X:113597870-113597892 CATCACAAAACTCTGGAGCAGGG + Intergenic
1197501588 X:127248968-127248990 TTCTACAAAGAGCTGGAGCTAGG + Intergenic
1198078751 X:133218789-133218811 TCTCACAAGAAGCTGGATCTGGG + Intergenic
1200391706 X:155952190-155952212 CTTAACAAAAAGATGCAGCAAGG + Intergenic