ID: 1150670663

View in Genome Browser
Species Human (GRCh38)
Location 17:67194030-67194052
Sequence TACTCCCTAGGGTCTTGTAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150670663_1150670667 4 Left 1150670663 17:67194030-67194052 CCATTACAAGACCCTAGGGAGTA 0: 1
1: 0
2: 0
3: 1
4: 79
Right 1150670667 17:67194057-67194079 GGATATAGTCTTATCATTTGAGG 0: 1
1: 0
2: 0
3: 11
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150670663 Original CRISPR TACTCCCTAGGGTCTTGTAA TGG (reversed) Exonic
902907560 1:19569668-19569690 TACTTCCTAGGGTGGTGGAAAGG + Intergenic
903677865 1:25075975-25075997 TATTCACGAGGGTTTTGTAAGGG + Intergenic
910699180 1:90053702-90053724 TACTCCCTAAGGTCACGCAAAGG + Intergenic
912680026 1:111723239-111723261 TCCTCCCTAGGGCCTTGTTGGGG - Exonic
916632782 1:166634951-166634973 TACTCCTTTGTCTCTTGTAATGG + Intergenic
916693963 1:167218551-167218573 TACCTCCCAGGGTATTGTAAGGG + Intergenic
922388505 1:225113760-225113782 TACTCCCTATGGACTTGTGGTGG - Intronic
1063341610 10:5270656-5270678 TAATCCCTAGGATCATGTGAAGG + Intergenic
1063772378 10:9218702-9218724 TACTGACTAAGGTCTTGCAAAGG - Intergenic
1069367227 10:67706562-67706584 TCCTCCCAAGGGACTTGGAATGG - Intergenic
1079633522 11:22707533-22707555 TACTTAGTAGGTTCTTGTAAGGG + Intronic
1089489027 11:118870170-118870192 GCCTCCCTAGGGTCTTCTGACGG + Intergenic
1094391643 12:29958318-29958340 ACCTCTCTAGGTTCTTGTAAGGG - Intergenic
1094569211 12:31627159-31627181 TATTCCCTTGGCTCTTGAAAGGG + Intergenic
1094594320 12:31850717-31850739 TTCTCCCAAGGGACTTGTATTGG - Intergenic
1105793123 13:23822586-23822608 CACTCCCTAGTGTCCTTTAAGGG - Intronic
1108427221 13:50314969-50314991 TAATCCCTTGGGGCTTGAAAAGG - Intronic
1115773307 14:36688527-36688549 TACTGCCCAGGGGCTTGCAAAGG - Intronic
1116010363 14:39344438-39344460 TCCTCCCTAGGATTTTGAAAGGG + Intronic
1116943008 14:50809571-50809593 GTCTCCCCAGGGTCTTCTAAAGG + Intronic
1121114441 14:91333744-91333766 TACTCCCTAGGGTCTAGGGTGGG + Intronic
1121408804 14:93735252-93735274 TACTTCCTAGTGTCTAGTCACGG + Intronic
1130124983 15:81085654-81085676 TCCTCCCCAGGGCCTTGGAAGGG - Intronic
1136709291 16:32222031-32222053 TCCTCCCTAGGGTCTTCAGAGGG - Intergenic
1136758619 16:32707388-32707410 TCCTCCCTAGGGTCTTCAGAGGG + Intergenic
1136809489 16:33162991-33163013 TCCTCCCTAGGGTCTTCAGAGGG - Intergenic
1136815965 16:33273071-33273093 TCCTCCCTAGGGTCTTCAGAGGG - Intronic
1137692608 16:50440007-50440029 TACTCTCTATGATCCTGTAATGG + Intergenic
1203060773 16_KI270728v1_random:967716-967738 TCCTCCCTAGGGTCTTCAGAGGG + Intergenic
1146608967 17:34287990-34288012 TCCTCCCTGGAATCTTGTAAAGG + Exonic
1150670663 17:67194030-67194052 TACTCCCTAGGGTCTTGTAATGG - Exonic
1155561460 18:27081887-27081909 TACTCCTTAGGTTCAAGTAAAGG + Intronic
1159918803 18:74209113-74209135 TACTCTCTAGGGTCCAGGAAAGG - Intergenic
928035116 2:27815615-27815637 ATCTTCCTAGGGTGTTGTAATGG - Intronic
928774726 2:34746665-34746687 TACTTCCTAGTCTTTTGTAACGG + Intergenic
938856684 2:135319990-135320012 TCCCTCCTAGGGTCTTGAAATGG + Intronic
945536892 2:211028226-211028248 TATTCCCTATGGTGCTGTAAAGG - Intergenic
945624234 2:212181121-212181143 GACTCCCTAGGCTCTGGTTATGG - Intronic
1170325997 20:15154961-15154983 GACTCCCTAGGTTCTTATTATGG + Intronic
1179210081 21:39316967-39316989 GACTCCCAAGGCTCTTGTAAAGG - Intronic
1179652545 21:42820974-42820996 TACTCTCCATGGGCTTGTAACGG + Intergenic
951336901 3:21434461-21434483 TTCTCCCTAGGGTGTGGTATGGG - Intronic
952177759 3:30884868-30884890 TACCTCCTAGGGTTTTGTGAGGG - Intronic
954610946 3:51944243-51944265 TACTCCCCAGGGTCCTCAAAAGG + Intronic
960554091 3:119008461-119008483 TACTCCCTAGGTTTCTGTACAGG - Intronic
960726208 3:120672897-120672919 TGATCCCTTGGGTCTTGAAAAGG - Intronic
962966990 3:140364636-140364658 TAGTCCCTGGGGTCTGGGAAGGG + Intronic
967344590 3:188440311-188440333 TACTTCCTAGGTTGTTGTCAAGG + Intronic
971059735 4:22954169-22954191 ACCTCCCTAGGGGCTTGAAAGGG + Intergenic
973628573 4:52797051-52797073 TACTCCCAGGGGTCTCCTAAGGG + Intergenic
982720211 4:158851648-158851670 TACTCCCCAGTGTCTTCCAAAGG - Intronic
991777996 5:70104215-70104237 TACTTCCTAGTGTGTAGTAAAGG + Intergenic
991857286 5:70979667-70979689 TACTTCCTAGTGTGTAGTAAAGG + Intronic
991870444 5:71104542-71104564 TACTTCCTAGTGTGTAGTAAAGG + Intergenic
993179680 5:84536246-84536268 TACCCCCCAGGTTTTTGTAAGGG + Intergenic
993595584 5:89850789-89850811 TACTCCAGAGGCTCTTGTTAGGG - Intergenic
994288647 5:98000670-98000692 TAATCCCAAGGCCCTTGTAAGGG + Intergenic
1009836231 6:69004923-69004945 TACTGCCTGTAGTCTTGTAAGGG + Intronic
1010644116 6:78366023-78366045 TACTGGTTTGGGTCTTGTAAAGG + Intergenic
1014406591 6:121059901-121059923 TACTCCCAAAGTTATTGTAATGG + Intergenic
1016852352 6:148633731-148633753 CACTGCCTTGGGTCCTGTAATGG + Intergenic
1023630595 7:42160110-42160132 TACTTCATAGGGTATTGTGAGGG + Intronic
1024607220 7:51031812-51031834 TACTCCCTAGAATCTTGAACTGG + Intronic
1026277618 7:68894014-68894036 AACTCCCTAGGGTCCCTTAAGGG - Intergenic
1030527208 7:110668826-110668848 TCCTCCATAGTGTCTTGTCATGG + Intronic
1033489193 7:141824907-141824929 TACTCCCTGTGGTCCTGTCATGG - Intergenic
1038812879 8:30869001-30869023 TACTCCCTGGAGTTTTGTATTGG + Intronic
1040503936 8:48030012-48030034 CACTCCCTAGTGTATTCTAAGGG + Intronic
1041640762 8:60198581-60198603 TAATCCCTGGTGTGTTGTAAGGG + Intronic
1048801612 8:138199179-138199201 CACTCCCAAGGGTGTTGTATAGG + Intronic
1053147987 9:35724946-35724968 TACTCCATAGTGTCCTGTTAGGG + Exonic
1054950098 9:70840437-70840459 TGTTCCCGAGGGTCTCGTAAAGG - Intronic
1056570549 9:87810925-87810947 TACTCCTTTGGGTTTTGTATTGG + Intergenic
1058811743 9:108646227-108646249 TACTCCACAAGGTCATGTAAGGG + Intergenic
1193722090 X:84999002-84999024 GACACCCTAGGATCATGTAAGGG - Intergenic
1194157835 X:90415351-90415373 TACTCCCCATGGGCTTGTAGTGG - Intergenic
1194799590 X:98255238-98255260 GACTCCCTAGGGTGTTGTTTGGG - Intergenic
1196320919 X:114339360-114339382 TACTCTCTAGGGTAGTTTAATGG + Intergenic
1198038780 X:132828077-132828099 TACTTCCTAGGGACTTGCCATGG + Intronic
1199295123 X:146148647-146148669 TCATCCCTATGGTCTAGTAAGGG + Intergenic
1200504164 Y:3992320-3992342 TACTCCCCATGGGCTTGTAGTGG - Intergenic