ID: 1150670684

View in Genome Browser
Species Human (GRCh38)
Location 17:67194280-67194302
Sequence TGTCCTAGCAACTGGTGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150670680_1150670684 15 Left 1150670680 17:67194242-67194264 CCAGCAGTTAGTTAAAATCAAGC 0: 1
1: 0
2: 0
3: 12
4: 119
Right 1150670684 17:67194280-67194302 TGTCCTAGCAACTGGTGGACAGG 0: 1
1: 0
2: 0
3: 8
4: 96
1150670679_1150670684 16 Left 1150670679 17:67194241-67194263 CCCAGCAGTTAGTTAAAATCAAG 0: 1
1: 0
2: 3
3: 12
4: 157
Right 1150670684 17:67194280-67194302 TGTCCTAGCAACTGGTGGACAGG 0: 1
1: 0
2: 0
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150670684 Original CRISPR TGTCCTAGCAACTGGTGGAC AGG Intronic
900364725 1:2306436-2306458 TGTCCTAGCAGGTGGAGGAGGGG + Intronic
902043151 1:13506836-13506858 TGTCCTAGCATCTTGTGGTCTGG - Intronic
902046806 1:13530705-13530727 TTTCCTGGTAACTGGTAGACAGG - Intergenic
902521998 1:17024007-17024029 TGCCCCAGCTACTGGTGGAACGG - Exonic
902991733 1:20192447-20192469 TGCCCGAGCATCTGGTTGACCGG + Exonic
905029157 1:34869945-34869967 TGTTCTAGCAGCTGGTGCAGTGG - Intronic
908515776 1:64891540-64891562 AGTCCTAGCAACATGTGAACAGG + Intronic
912472660 1:109916247-109916269 TGTCCAAGCAACTGATTGAGGGG - Intronic
912558809 1:110535528-110535550 TGCCCCAGCAACCGGAGGACAGG - Intergenic
912673085 1:111649395-111649417 TGTCCCAGAAGCTGGTGGAGTGG + Intronic
920851612 1:209631900-209631922 TGTCCTAGTGACAGGGGGACAGG - Intronic
922798418 1:228352940-228352962 CGTCCTTGCAGCTGGTGAACCGG + Exonic
1064554078 10:16530813-16530835 TGTTCTAGGAAATGGTGAACTGG - Intergenic
1067262736 10:44708510-44708532 TGTCCTAGCAAAAGCAGGACTGG + Intergenic
1074076015 10:110126107-110126129 TGTGCTAGTAATTGGTGAACAGG + Intronic
1077816353 11:5689646-5689668 TGTTCTAGCATCTGCTGTACTGG - Intronic
1082722148 11:56691331-56691353 TGTCCAACCTACTGGTGAACTGG - Intergenic
1084644298 11:70445737-70445759 GGTCCTAGGAGCTGGTGGCCAGG + Intergenic
1088169196 11:106976585-106976607 TGTGCCAGCATCTGGTTGACAGG + Intronic
1089212556 11:116815625-116815647 TTACCTAGCAAGTGGTGGAATGG - Intergenic
1093680932 12:22002598-22002620 AACCCTAGCAACTGGTGGTCTGG + Intergenic
1100104587 12:91154464-91154486 TGTGATAGCAATTGGTGTACTGG - Intronic
1104909017 12:132230686-132230708 TGTCCCAGCTACAGGAGGACCGG - Intronic
1106410123 13:29505766-29505788 TGTCCCAGCATGTGGTGGGCAGG - Exonic
1107731447 13:43353023-43353045 TGTCCTAGCCAGTGGTGGAAAGG - Intronic
1115662751 14:35512918-35512940 TGCCCCAGAAACTGGTGGAGTGG + Intergenic
1117211380 14:53504017-53504039 TGTCCTAGCAACTCATGAAGTGG + Intergenic
1121634069 14:95441821-95441843 TGTCCTGGAAACTGGTGGGGAGG + Intronic
1122694666 14:103546857-103546879 TGCCCTGGCCAATGGTGGACAGG - Intergenic
1202906661 14_GL000194v1_random:77620-77642 TGTGCCAGGAGCTGGTGGACTGG - Intergenic
1129653257 15:77506360-77506382 TGAACCAGCAACTGGTGGAGAGG - Intergenic
1132295679 15:100732546-100732568 CTTCCTCGCAGCTGGTGGACTGG - Intergenic
1132546257 16:534749-534771 TGTCCAGGCAGCTGGTGGCCTGG - Intronic
1133170465 16:3979715-3979737 GGTCCTGGCATCTGGTGGGCAGG + Intronic
1138345679 16:56318553-56318575 TTTCCCTGCAACTGGAGGACTGG + Intronic
1140094866 16:71866369-71866391 ACTCCAGGCAACTGGTGGACTGG + Intronic
1147561749 17:41513586-41513608 TGTCCCAGCCACTGGTGCCCTGG + Intergenic
1148074166 17:44926144-44926166 TGCCCTAGCAACCGGAGGAATGG - Exonic
1148756134 17:49973856-49973878 TGCCATAGCCACTGGTGGGCAGG - Exonic
1150670684 17:67194280-67194302 TGTCCTAGCAACTGGTGGACAGG + Intronic
1154327721 18:13404037-13404059 TAGCCTAGCCACTGGGGGACAGG - Intronic
1156254350 18:35380712-35380734 TTTCCAAGCAAGTGGTGGATGGG + Intergenic
1159940250 18:74401378-74401400 TGGCATAGCACCTGGTGCACTGG - Intergenic
1160346915 18:78139649-78139671 TGTCCCTGCAACTGATGGATAGG - Intergenic
1161453846 19:4360710-4360732 TGTCCCAGCCCCTGGTGGCCAGG - Exonic
1165485205 19:36091226-36091248 TGTCAGAGCAGCTGGTGGCCAGG - Exonic
1168411621 19:56143807-56143829 CGTCTTAGCAACTGGGGGAAGGG + Intronic
926433489 2:12815025-12815047 TGTCCAAGCAAATGATGCACTGG - Intergenic
926958377 2:18327422-18327444 TGTGATAGCTACTGGTGGACGGG + Intronic
936115644 2:109700877-109700899 TGGCCTAGCAACAGGTGGGAAGG + Intergenic
941085544 2:161113169-161113191 TGACTTAGCAGCTGGTGGAAAGG + Intergenic
941804064 2:169692833-169692855 TGACTTAGCAACTGGTAGAGGGG - Intronic
943374378 2:187056751-187056773 TGTCATAGCAACAGTTTGACTGG - Intergenic
944033892 2:195269538-195269560 GGTCTTAGCAACTGGCAGACAGG - Intergenic
948425149 2:237882733-237882755 TGTCCAAGTAACTAGTGGAGGGG + Intronic
949053396 2:241910085-241910107 TGTCCTGGAACCTGGTGGCCTGG + Intergenic
1169380235 20:5100161-5100183 TGTCCAACCTACTGGTGAACTGG + Exonic
1170697779 20:18675211-18675233 TGTCCTCACAACATGTGGACTGG + Intronic
1175093679 20:56524742-56524764 TGCCCTCGCAACTGGGAGACTGG - Exonic
1175094870 20:56533275-56533297 TGCCCTCGCAACTGGAAGACTGG - Exonic
1175574914 20:60053664-60053686 AGCCCGAGCAACAGGTGGACTGG + Intergenic
1175602699 20:60287792-60287814 TGGCCCAGCAACTGGGGGCCTGG + Intergenic
1176626009 21:9092419-9092441 TGTGCCAGGAACCGGTGGACCGG - Intergenic
1178263473 21:31121038-31121060 TGTTCTAGCAACTGATGCAAGGG + Intronic
1179530797 21:42017948-42017970 TGTCCTTGCAATCAGTGGACTGG + Intergenic
1181752236 22:24996839-24996861 TGTCATAGCAGCTGGGGGATGGG + Intronic
1182718146 22:32376512-32376534 AGTCCTAGGGGCTGGTGGACAGG - Intronic
1183028837 22:35086845-35086867 TGTCCTTGCAGGTGGAGGACAGG + Exonic
950686258 3:14620647-14620669 TGTCCTAGCAACTGGAAAAGGGG - Intergenic
957241112 3:77662279-77662301 TGTCCTGGCAACTGGTGGTGGGG - Intergenic
963325171 3:143854614-143854636 TGTTCTAGCAGCTGTTGGAGAGG + Intergenic
963785979 3:149534830-149534852 TTTCCTAGCAGCTGGAGGACGGG + Intronic
973589696 4:52428536-52428558 TGTCCTAGAAACTGGTGGTGAGG + Intergenic
974467516 4:62276009-62276031 TGTCCTCGAAACTATTGGACAGG - Intergenic
978122946 4:105103301-105103323 TGTTATAGCTACTGGTGGCCAGG - Intergenic
984833387 4:183997385-183997407 GGTCCTAGCATAGGGTGGACAGG + Intronic
989084861 5:37665454-37665476 TGTCCAAGCATCTGCTGCACAGG + Intronic
992673475 5:79082246-79082268 TGTCTTTGCCAGTGGTGGACAGG - Intronic
994871029 5:105350830-105350852 TGTCCAAGCAGCTGGTGAGCAGG + Intergenic
1000720436 5:164699566-164699588 AGTCCCAGCTACTGGTGGAAGGG + Intergenic
1001317436 5:170653855-170653877 GGGCCAAGCAACTGGTGGCCAGG + Intronic
1004762931 6:18690682-18690704 TGTCCTAGAAGATGGTGAACAGG - Intergenic
1005649149 6:27870521-27870543 TATCCCAGCAACTGGTGCAGCGG - Intergenic
1005962304 6:30703026-30703048 TGCCCTAGAAAGTGGTGGAAGGG - Intronic
1007965607 6:46001302-46001324 TGCCCTAGCAACAGGTCTACGGG + Intronic
1008070496 6:47094534-47094556 GGTTCTACCACCTGGTGGACCGG - Intergenic
1009523543 6:64714874-64714896 TCTCCTAGCAACTGGTAGAGGGG - Intronic
1014056810 6:117025462-117025484 AGTGCTAGCAACTGGGGGAAGGG - Intergenic
1018210342 6:161475231-161475253 TGTCCTATCAACTGGTGTGATGG + Intronic
1020001249 7:4757205-4757227 TTTCCTAACAGCTGGAGGACGGG - Intronic
1023064878 7:36367217-36367239 TTTCCTAGCAACCGGCGGAGCGG - Intronic
1023668998 7:42556290-42556312 TGTCGTAGCAACTGGAAGAATGG + Intergenic
1024914001 7:54478109-54478131 TGAACTAGCACCTGATGGACTGG - Intergenic
1030936736 7:115594108-115594130 AGTCTTAGCAACTGGCAGACCGG + Intergenic
1038437082 8:27543807-27543829 TGTCCCAGCACATGGAGGACTGG + Exonic
1042509060 8:69592227-69592249 TGTCCTAGAAACTGGAGAATGGG + Intronic
1042875993 8:73440435-73440457 TGCCTGAGCAACTGGTGGAACGG - Intronic
1046030520 8:108777881-108777903 TGTCCTTTCAACTCATGGACAGG - Intronic
1049796603 8:144499957-144499979 TCTCCCAGCAGCAGGTGGACAGG + Intronic
1050185198 9:2965744-2965766 TGGCCTGGGTACTGGTGGACTGG - Intergenic
1185466143 X:355461-355483 TGTCGTAGCAACGGAGGGACCGG + Intronic
1195238474 X:102926407-102926429 TGCCCTGGTGACTGGTGGACAGG + Intergenic
1195814308 X:108868470-108868492 TTTCCTAGAAACTGGTTGACTGG - Intergenic
1198204603 X:134453885-134453907 TGACTTACCAACTGGTGGCCTGG - Intergenic
1199461242 X:148087878-148087900 TGTCCTTGCAACTACTGGAGAGG + Intergenic