ID: 1150674137

View in Genome Browser
Species Human (GRCh38)
Location 17:67230047-67230069
Sequence TCATTAAAACAGATGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 278}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150674137 Original CRISPR TCATTAAAACAGATGGCAGA AGG (reversed) Intronic
902755088 1:18543820-18543842 GTATTAAAACAGCTGGCACATGG + Intergenic
907957070 1:59239753-59239775 TCATTATATCAGAAGGCACATGG - Intergenic
908238187 1:62167350-62167372 TCATGAAAAGACATGGAAGACGG - Intergenic
909188922 1:72526708-72526730 TCATTAATACAGAAGGCAGATGG - Intergenic
911315714 1:96354420-96354442 TTATTATAACACCTGGCAGATGG + Intergenic
911395973 1:97310621-97310643 TCAGAAAAACAGATGCAAGAAGG - Intronic
912557600 1:110527457-110527479 TCATGAAAACTGGTGGCTGAGGG - Intergenic
914343676 1:146780481-146780503 TACTTAAAACAGATTCCAGATGG - Intergenic
914443103 1:147723997-147724019 TGATTAAAGGAGATGGCTGAAGG - Intergenic
916177026 1:162050609-162050631 TTTTTAAAACAGGTGGTAGAAGG - Intergenic
916755358 1:167764129-167764151 TCTTTAAAAAATATGGAAGATGG + Intronic
917621540 1:176801570-176801592 TTAGAAAAACAGATGGCAGTGGG + Intronic
918357580 1:183720128-183720150 TCATTAAGATACATAGCAGAAGG + Intronic
918536547 1:185581406-185581428 TCAGTAAAAGATATGGCTGAAGG - Intergenic
919045042 1:192440771-192440793 TAATTAAAATAAATGTCAGATGG + Intergenic
919057686 1:192591320-192591342 TAATTAGAATACATGGCAGATGG + Intergenic
920952978 1:210590272-210590294 TCATGAAAAGAGAGGGAAGAAGG - Intronic
921009113 1:211123561-211123583 TGATGAAGACAGATGGAAGACGG + Intronic
921098546 1:211908655-211908677 TCATAGAAACAGAGAGCAGAGGG - Intergenic
921808205 1:219479967-219479989 TCATTCACACAGGTGGTAGAAGG + Intergenic
921952326 1:220943338-220943360 TCATATAAACAGATGGGAAAAGG + Intergenic
923383171 1:233441745-233441767 TCATCAAAACACCTGGCACACGG + Intergenic
924063333 1:240198618-240198640 ATATTAGAACAGATGGCAAATGG - Intronic
924130866 1:240906663-240906685 TTATTATAACAGCTGGCAGCTGG + Intronic
1062963454 10:1590704-1590726 TCATAGAAACAGAGAGCAGAAGG + Intronic
1063073762 10:2693360-2693382 TCATTAAAACTGATGCCATTAGG - Intergenic
1064032464 10:11891648-11891670 TCATTCAAACTGAGGGCAGGGGG - Intergenic
1066266114 10:33777054-33777076 ACAGTAAATGAGATGGCAGAGGG + Intergenic
1067268486 10:44768848-44768870 TCATAAAAACAAATTCCAGATGG - Intergenic
1068298924 10:55113459-55113481 TAATTAAAATACATGGAAGAAGG + Intronic
1068844453 10:61656351-61656373 TCATTCAAAAAGAAGGCACATGG + Intergenic
1068979951 10:63051672-63051694 TGATTAGAACAAATGACAGAAGG + Intergenic
1071253848 10:83849135-83849157 TTTTTAAAAGAGATGCCAGAAGG + Intergenic
1079357649 11:19743348-19743370 GCAACAAGACAGATGGCAGAAGG + Intronic
1079511543 11:21216482-21216504 TCATGAAAGCAGCTGGGAGAGGG + Intronic
1079928979 11:26533734-26533756 ATATTCAAACAGATGGCAAACGG - Intronic
1079946805 11:26753520-26753542 TCATTTTATCTGATGGCAGATGG - Intergenic
1080280678 11:30553251-30553273 TTTTTAAAAAAGAAGGCAGAAGG + Intronic
1080678359 11:34449077-34449099 AAATTAAAAAAGAGGGCAGATGG + Intronic
1084915658 11:72427082-72427104 TAATGAATACAGATGGCAGAGGG + Intronic
1085000002 11:73024479-73024501 ACATGTAAACAGATGGCAGAGGG + Intronic
1085272602 11:75279090-75279112 TCACCAAAATAGATGACAGAGGG - Intronic
1085956090 11:81397120-81397142 TCATTAAAACAGATTGCTGATGG - Intergenic
1086728519 11:90219884-90219906 TCTTTTAAGCAGATTGCAGAGGG - Intronic
1086919797 11:92573382-92573404 CCAATAAAACAGAAAGCAGAGGG - Intronic
1090095298 11:123736979-123737001 ACAAAAAAACAGATGGCATAAGG + Intronic
1091364036 11:135002211-135002233 TCATTAAGACAGAGAGCAGCAGG - Intergenic
1091816093 12:3439272-3439294 ACATTAAAACAGATGGGTGGAGG - Intronic
1092389034 12:8059129-8059151 TCATGATAACAGAGGGCAGCAGG + Exonic
1095033173 12:37320914-37320936 ACATTAAAAAAGCTAGCAGAAGG - Intergenic
1095815305 12:46415497-46415519 TCATGGAAACAGAGAGCAGAAGG - Intergenic
1096969211 12:55651955-55651977 CCATTAAAACAGCTGGGAGGGGG + Intergenic
1097856858 12:64472514-64472536 TCATGAAGGCAGATGGCAGGAGG + Intronic
1099736628 12:86575393-86575415 TCATTAACATAGAAAGCAGAAGG - Intronic
1100764090 12:97844221-97844243 TCTTTAAAACAGAAAGCAAATGG - Intergenic
1101541274 12:105667729-105667751 TTATTAAAATGGATGGCAAAGGG - Intergenic
1101900085 12:108785445-108785467 GCATGTAAACAGATGGCACATGG - Exonic
1102777157 12:115530323-115530345 TCTTTACAACAGAGAGCAGATGG + Intergenic
1103666608 12:122571970-122571992 TCATTAAAACAGGTGGAGGGGGG - Intronic
1103843975 12:123888469-123888491 TCCTTATAAGAGAAGGCAGAGGG + Intronic
1105602858 13:21902561-21902583 TCCATAAAGCTGATGGCAGATGG + Intergenic
1108691657 13:52864512-52864534 TTATTAAAACAGGTGGAAGATGG + Intergenic
1109787711 13:67202498-67202520 CCATTAAAACAGTGGGCAGTTGG - Intronic
1111838791 13:93423829-93423851 TCATTAATAGAGATGGCTAATGG + Intronic
1111876890 13:93908873-93908895 ACATTTAAACAGATACCAGAAGG - Intronic
1112002382 13:95222706-95222728 TCATTAACACACCTGGCATACGG + Intronic
1112683357 13:101793202-101793224 TCATGAAAACAGAGGGTAGATGG - Intronic
1114671578 14:24414571-24414593 ACACCAAAACAGATGGAAGAGGG - Intronic
1114796796 14:25725027-25725049 ACATTATAACAGATGGCATCTGG + Intergenic
1116199169 14:41770022-41770044 TCATTATGACAGAAGGCAAAGGG + Intronic
1118491236 14:66262945-66262967 ACATTAAAACAGAAGGTACATGG - Intergenic
1119530856 14:75360158-75360180 TCATTGGAAAAGATGGCTGAAGG - Intergenic
1121619838 14:95338456-95338478 TCATGGAAACACAGGGCAGAGGG + Intergenic
1121700384 14:95949295-95949317 TCAATAATACAGATGTCAGCTGG - Intergenic
1121719806 14:96101371-96101393 CCTTTAAAACAGAGGGCACAGGG - Intergenic
1126724572 15:51618822-51618844 TAATTATAACATAAGGCAGATGG - Intronic
1127278187 15:57465948-57465970 TCTTTAAAAGATATGGCTGATGG - Intronic
1128182788 15:65619694-65619716 TTATTAAAACAGAAAGAAGAGGG - Intronic
1128990811 15:72258581-72258603 TCAATCAATTAGATGGCAGAAGG + Intronic
1129442737 15:75593620-75593642 TCTTTAAAACAGGTGGCAAGAGG - Intergenic
1129627102 15:77213393-77213415 TTTTGAAAACAGATGGCAGCCGG + Intronic
1131315314 15:91330516-91330538 TTAAGTAAACAGATGGCAGATGG - Intergenic
1131919409 15:97307379-97307401 TCATAGAAACAGAGAGCAGAAGG - Intergenic
1133455079 16:5935079-5935101 TCAGTAAAAGAGTTGGCTGAAGG - Intergenic
1134535432 16:15023147-15023169 AAATGAAAACTGATGGCAGAAGG - Intronic
1136144785 16:28310134-28310156 TCAGCAACACAGATGGCAGATGG + Intronic
1136567111 16:31077123-31077145 TCCTTGAAACAGATGGCACAGGG - Exonic
1136909854 16:34136195-34136217 TGAGTCAAACAGATGGCAGGGGG - Intergenic
1137314376 16:47300680-47300702 ACCTTAAAATAGAAGGCAGATGG + Intronic
1137723904 16:50644444-50644466 TCATAAAGACAGATGGGAAAAGG + Intergenic
1137970205 16:52977133-52977155 TCATTATATCAGATGGCCAAAGG - Intergenic
1139263549 16:65618648-65618670 TAATTAAAGCACAGGGCAGAGGG + Intergenic
1139466734 16:67158061-67158083 TCATGTAAACAGATGGCAGCTGG - Intronic
1139860612 16:70017645-70017667 AAATGAAAACTGATGGCAGAAGG + Intergenic
1139990316 16:70934853-70934875 TACTTAAAACAGATTCCAGATGG + Intronic
1141466347 16:84208337-84208359 TTATAAAAACAGGTTGCAGATGG + Intergenic
1203048279 16_KI270728v1_random:853120-853142 TTATTAAAACACATGCCAAATGG - Intergenic
1142693217 17:1619527-1619549 TCAGCCAAACACATGGCAGACGG + Intronic
1145745500 17:27316558-27316580 TCTTTAAAACAGAAACCAGAAGG - Intergenic
1147674986 17:42199012-42199034 TCATTAGCTCTGATGGCAGATGG - Intergenic
1149351700 17:55795137-55795159 TTAATAAAACTGATGGCAGGGGG - Intronic
1150423834 17:65060787-65060809 TCCATAAAACAGAAAGCAGATGG + Intergenic
1150674137 17:67230047-67230069 TCATTAAAACAGATGGCAGAAGG - Intronic
1150992426 17:70275188-70275210 TCATGAAAACACATAGCACATGG - Intergenic
1151396201 17:73824670-73824692 TCATTGAAATAAATGGCAGGAGG - Intergenic
1151448261 17:74181410-74181432 TCATTTAAACAGATGGCTGCAGG + Intergenic
1152259644 17:79260140-79260162 TGATTAAACCAGGTGGCCGATGG - Intronic
1154204956 18:12328397-12328419 TCCTTAAAAAAGATGGCATGAGG - Intronic
1156544694 18:37952650-37952672 TCATTAAAAGAGATGTTACAAGG - Intergenic
1157457075 18:47841940-47841962 TCTTTTAAACAGAAGGCAGACGG - Exonic
1158092302 18:53728372-53728394 TGATCATAACAGATGGCAAAGGG + Intergenic
1159045411 18:63365418-63365440 ACATTAAAAAAGAAGACAGATGG + Intronic
1159695750 18:71554070-71554092 TCATGAAAACAGATCCCTGATGG + Intergenic
1161888544 19:7016415-7016437 TTATTAAAACAGATCCAAGAAGG - Intergenic
1161997080 19:7719812-7719834 TCATAAATGCAGATGGCAGGTGG + Intergenic
1162328812 19:10014294-10014316 TCTCTAAAACAGAGGGCAGAGGG - Intronic
1163881558 19:19927508-19927530 TCATAAAAACAGAAAGTAGAAGG - Intronic
1164278727 19:23749287-23749309 TCATAAAAACAGAAAGTAGAAGG + Intronic
1164317903 19:24110719-24110741 TCATAAAAACAGAAGGTGGAAGG - Intronic
1164465419 19:28483505-28483527 TCATTATTTCAGATGCCAGAAGG - Intergenic
925655807 2:6147023-6147045 TCACTCAAAGAGATGGGAGAGGG - Intergenic
926444971 2:12930555-12930577 TCATTAAAGCAGATGAGAAATGG + Intergenic
926794117 2:16604792-16604814 TCATTGCAAAAAATGGCAGATGG - Intronic
928362773 2:30679049-30679071 TCATTTAAGTAGATGGCAGGGGG - Intergenic
928475200 2:31618631-31618653 TCATAAAAACAGAGAGTAGAAGG + Intergenic
928515620 2:32042173-32042195 TCATTAAAAAAAATTGCAGACGG - Intergenic
928592032 2:32827104-32827126 TCAGTAAAACACATGGAAGCAGG + Intergenic
928802114 2:35107538-35107560 CCATTCTAACAGATGTCAGATGG + Intergenic
929055022 2:37869214-37869236 ACATTAACTCACATGGCAGAGGG - Intergenic
930046781 2:47179560-47179582 TCATTAGCACAGATGGCTGGAGG - Intergenic
930384617 2:50678523-50678545 TCAGTGATACAGATGGCTGAAGG - Intronic
930817741 2:55616928-55616950 TCCTTAAGAGAGATGGGAGAAGG + Intronic
931118503 2:59190712-59190734 TTACTAAAACAGATGTCAGATGG + Intergenic
933101271 2:78261400-78261422 TCAATAAAACTCATGGCAGCTGG - Intergenic
933741232 2:85536047-85536069 TCAAAAAAAAAGATGGCAGAAGG - Intergenic
933887461 2:86732325-86732347 TCATAAAAATAAGTGGCAGACGG + Intronic
935114355 2:100121722-100121744 TGATAAAAAAAGATGGCAGATGG + Intronic
935201228 2:100858353-100858375 GCATTAAAGCAGATGACAAAGGG - Intronic
936702695 2:115032961-115032983 TGATTAAAACAGAGAGCAAAGGG - Intronic
938861802 2:135377113-135377135 TTAAGTAAACAGATGGCAGATGG + Intronic
939146676 2:138424101-138424123 TCAGTTAGACAAATGGCAGAAGG + Intergenic
939386489 2:141506329-141506351 TCATTATAACAGTTGACACAAGG - Intronic
940003764 2:148993048-148993070 CCATTTAAACAAATGGCAGCCGG - Intronic
940236235 2:151513492-151513514 CCAATAAATCAGATGACAGAGGG + Intronic
940375304 2:152951189-152951211 TCATTAGAATAGTTGGCACAAGG + Intergenic
941144401 2:161825760-161825782 TCCTTAAAAGGGATGGCAGTAGG - Intronic
941348897 2:164406813-164406835 TCTGTAAGACAAATGGCAGAAGG + Intergenic
942091505 2:172495862-172495884 TCTTTAAAACAGCTGACAGTAGG - Intronic
942985747 2:182139376-182139398 ACATTTAAACAGAGGACAGAAGG + Intergenic
943278187 2:185896162-185896184 TCCTAAAAGCAGATGCCAGAAGG - Intergenic
943372857 2:187037334-187037356 TCATTTAAACATATAACAGAGGG - Intergenic
943862061 2:192879113-192879135 TCATTTAATCAGATGTCAGATGG - Intergenic
945407146 2:209462228-209462250 GAAATAAAATAGATGGCAGATGG + Intronic
947014178 2:225599666-225599688 CCAGTAAAACTGATGGAAGAAGG + Intronic
947416773 2:229904574-229904596 TTATTAAAACAGAGGCTAGAAGG + Intronic
947891089 2:233621101-233621123 ACTTTAACAAAGATGGCAGATGG + Intronic
1169397333 20:5243993-5244015 TCCCTAAAAAAGAGGGCAGATGG + Intergenic
1169576821 20:6972002-6972024 TCATTAAAAAATATAACAGAGGG + Intergenic
1170302199 20:14896746-14896768 TCATTAAAGAAAATGACAGATGG + Intronic
1172270974 20:33655688-33655710 TAATAAATAAAGATGGCAGAGGG + Intergenic
1174076999 20:47944478-47944500 TCATTGAAACAGATGTAATATGG - Intergenic
1174459016 20:50669770-50669792 TCATTAAGACAAGGGGCAGAGGG + Intronic
1177295479 21:19168583-19168605 TTTTTAAAACAGATTGAAGATGG + Intergenic
1177551328 21:22626572-22626594 TGATTATAACAGATACCAGAGGG + Intergenic
1178414150 21:32390195-32390217 TCATTTGAACACATGTCAGAAGG - Intronic
1178679786 21:34664295-34664317 TCCTTATAATATATGGCAGAAGG + Intergenic
1179279639 21:39923690-39923712 TCCTTCACACAGATGGCTGAAGG - Intronic
1179439282 21:41381826-41381848 TCACTAAAGCAGTTGGCAGGAGG + Intronic
1179474145 21:41632687-41632709 TATTTAAAAGAGATTGCAGAAGG - Intergenic
1181481986 22:23205832-23205854 ACATGAAAACAGGTGGCAGTGGG + Intronic
1182206790 22:28635985-28636007 TCATAAAAACAGAGAGTAGAAGG - Intronic
1182949480 22:34358780-34358802 AGATTGAAACAGATGGCATATGG + Intergenic
1184834915 22:47015379-47015401 TCATTTAAACAGAGGGCCGAAGG - Intronic
955069789 3:55562451-55562473 TAATTAAAAAAGAAGGCAGCGGG - Intronic
955114826 3:55987467-55987489 TCTTGAAAACAAGTGGCAGATGG - Intronic
955134485 3:56202742-56202764 TCATAAAAACAGACAGTAGAAGG + Intronic
955925264 3:63998113-63998135 TCACTAATACAGATGTGAGATGG - Intronic
956429931 3:69176377-69176399 TTACCAAAACAGATGGCAGCTGG + Intronic
956475179 3:69611825-69611847 TCATGAATCCAGATGGCAGAAGG + Intergenic
957241107 3:77662191-77662213 TCTTTAAGCCAGATGGCAAATGG + Intergenic
957284548 3:78201564-78201586 TCATAGAAACAGAGGGCAGAAGG + Intergenic
957408185 3:79799757-79799779 TTATTCACACAGCTGGCAGAAGG + Intergenic
958936313 3:100260074-100260096 TGAGCAAAACAGATTGCAGACGG - Intergenic
959228226 3:103614186-103614208 TCTTTAAAATAGATGGAATATGG - Intergenic
959921229 3:111870529-111870551 ACATCAAAACACATGGAAGAGGG - Intronic
959934816 3:112018490-112018512 TCATTAAAACAAAGGTCAGTAGG - Intergenic
962170510 3:133096641-133096663 GTATTAAAATAGATGACAGATGG + Intronic
962433941 3:135347316-135347338 TCAGGAAGACACATGGCAGAGGG - Intergenic
963203761 3:142611832-142611854 TAATTAAAACAAATAGCAAAAGG - Intronic
964022405 3:152029096-152029118 ACTTTAAACCAGATGGCAAAAGG - Intergenic
964192429 3:154018786-154018808 CCATGAAAACAGTTGGAAGAGGG + Intergenic
964316325 3:155448164-155448186 ACAGTTAAACAGATGGTAGATGG - Intronic
965427408 3:168544674-168544696 TCCTTAAAAGGGTTGGCAGAGGG + Intergenic
965933175 3:174071966-174071988 TCTTTAAAAAAGATTTCAGAGGG + Intronic
966094132 3:176178015-176178037 TCAATAGAACACATGTCAGAGGG + Intergenic
966638877 3:182167167-182167189 TCTTTAAAACAAATTCCAGATGG - Intergenic
967747759 3:193079434-193079456 ATATTAAAAGAGAAGGCAGAAGG - Intergenic
968326148 3:197818423-197818445 TTATTAACAAAGATGGAAGATGG + Intronic
968686072 4:1959685-1959707 TCATCAAGACAGATGGCAAAGGG + Exonic
969065367 4:4475250-4475272 TTATTAAAACAGAGTGCAGGTGG + Intronic
971524560 4:27600643-27600665 TCTTTCAAACAAATGTCAGATGG - Intergenic
972248339 4:37270974-37270996 TCTTTTTAACAGATGGCACAAGG - Intronic
972900591 4:43677619-43677641 TCATTAAAACAGAATGTACATGG + Intergenic
973167528 4:47095999-47096021 TCCTTAAAATAGAAGGAAGATGG - Intronic
973230411 4:47834627-47834649 ACAATAATAAAGATGGCAGAAGG + Intronic
973709687 4:53616078-53616100 TCATGAACACAGAGAGCAGAAGG - Intronic
975495931 4:75035934-75035956 TAATTAAACCAGATGGAAAAAGG - Intronic
977260171 4:94788068-94788090 TCACTGTAACTGATGGCAGAAGG - Intronic
978044936 4:104114367-104114389 CCATGAAAACAGGTGGGAGAGGG - Intergenic
978449609 4:108817425-108817447 TCTTTAAAACAGGGGCCAGATGG - Exonic
978802718 4:112770751-112770773 TCATTAAAACAGATTTCTGAGGG + Intergenic
980092583 4:128457893-128457915 CCATAGAAACAGATGGCTGATGG + Intergenic
982470629 4:155786101-155786123 TCACTCAAGCAGATGGCATAAGG - Intronic
984124558 4:175791177-175791199 TAAATAAATCAGATGGCAGATGG + Intronic
984471274 4:180177566-180177588 TCATTAAAATAGATAACAAAAGG - Intergenic
984597846 4:181691556-181691578 TCATTAAAATAAATAGCATAAGG - Intergenic
986426804 5:7640069-7640091 TTATTAAAACACTTGGCTGAGGG + Intronic
987091310 5:14510246-14510268 TCAGAAAGACAGATGGCTGAGGG + Intronic
987538573 5:19222466-19222488 TCATTAAAAGGGATTGCAAAAGG + Intergenic
987608356 5:20168937-20168959 TCATGAACATAGATAGCAGAAGG + Intronic
987918430 5:24247830-24247852 TCATTAAAACACATGGAAATAGG + Intergenic
988977257 5:36527496-36527518 AGATTAAAACAGATGGGTGATGG - Intergenic
990532210 5:56685561-56685583 TCATAAAAATAGAAGGTAGAAGG - Intergenic
990834319 5:59999113-59999135 TCATTGAAACAGATGAGAAAAGG + Intronic
992571392 5:78062303-78062325 TCATCAAATCACTTGGCAGAAGG - Intronic
992620579 5:78588528-78588550 TCATTAAAAAAAATAGGAGATGG - Intronic
994513002 5:100731698-100731720 TCATGAAAACAGATGTTGGAAGG + Intergenic
995504419 5:112844108-112844130 TCTTTTAAACAGATGTCACAAGG - Exonic
995914279 5:117224736-117224758 TCATTTAAAAACATGGCAGAGGG + Intergenic
996614550 5:125425116-125425138 TGACTAAAGCAGCTGGCAGATGG - Intergenic
997614099 5:135234725-135234747 TCATTAAAACTGATGCCTCAGGG + Intronic
998295393 5:140965299-140965321 TCAGTAAAAGAGAAGGTAGAAGG - Intronic
998791731 5:145772878-145772900 TCTTTAAAACAGTTTGTAGATGG - Intronic
1000687524 5:164271020-164271042 AATTTAAAACAGAAGGCAGAAGG - Intergenic
1000983822 5:167845570-167845592 TGCTTAAAACAGCTGGCATATGG + Intronic
1001178222 5:169493034-169493056 TCATGAAGACAGAGGGCAGAAGG + Intergenic
1001517681 5:172367232-172367254 TATTGAAAACAGATGGCAGCCGG - Intronic
1002211727 5:177603503-177603525 TCATGATAAAAGATGGGAGATGG - Intronic
1002874452 6:1199354-1199376 TCATGAGAAGAGATGGAAGAGGG + Intergenic
1003513830 6:6802617-6802639 TGATTCAAGCAGATGGCAGGGGG - Intergenic
1005765696 6:29009649-29009671 TAATTTTGACAGATGGCAGAAGG - Intergenic
1007391838 6:41553821-41553843 CCATTAAAACACAGGGCAGAGGG + Intronic
1007641340 6:43342334-43342356 CCATTAAAACAGTTGGCAGAGGG - Intronic
1008654809 6:53601195-53601217 CCTTTAGAACAGATGGGAGAAGG + Intronic
1009271941 6:61624839-61624861 TCATTAGAACTAATGGCAGATGG - Intergenic
1011582889 6:88890173-88890195 TCATTAAAAAACAAGGCAGTGGG + Intronic
1012779245 6:103535886-103535908 TCAGAAAAACAGAGGGAAGAGGG - Intergenic
1014512919 6:122346699-122346721 AGATTAAAACAGATGTCAGCTGG - Intergenic
1014835707 6:126158032-126158054 TAATTATTACATATGGCAGAAGG - Intergenic
1017189530 6:151637249-151637271 ACATGAATCCAGATGGCAGAAGG - Intergenic
1017944533 6:159083563-159083585 ACATTAAAACAGATACCAGTGGG - Intergenic
1019744910 7:2694212-2694234 TGAATAGAACAGACGGCAGAGGG + Intronic
1020501582 7:8929336-8929358 TCATAAAGACTTATGGCAGAAGG - Intergenic
1020728705 7:11851278-11851300 TCATTAAAAATGATGGCATTTGG - Intergenic
1020918356 7:14227763-14227785 TCATTAAAACAAAAAGCAGCAGG + Intronic
1022403244 7:30061750-30061772 TCATGAAAACATAAGGAAGAAGG + Intronic
1022421686 7:30229575-30229597 GGACTAAAACAGAGGGCAGAGGG - Intergenic
1023249393 7:38241513-38241535 TCATTATAACAAAAGACAGAAGG + Intergenic
1029035865 7:97521006-97521028 TCGTTAAAACTGAAGGAAGATGG - Intergenic
1029574211 7:101392327-101392349 TCATAACAACAGATGGAAAAAGG - Intronic
1029642393 7:101829377-101829399 TCATGGGAACAGATGGCGGACGG + Intronic
1031909939 7:127505443-127505465 ACATGAAAACAGCTGGGAGAGGG - Intergenic
1032319948 7:130876742-130876764 TCATTATAACCGATTTCAGATGG + Intergenic
1032763980 7:134973575-134973597 TCATTAAAATAGATTTTAGAAGG + Intergenic
1032963475 7:137068009-137068031 TCATGAAAACAAAAGGCAGAAGG - Intergenic
1033460116 7:141539276-141539298 TAATTTAAACAGATGGCTCAGGG + Intergenic
1033915253 7:146316108-146316130 TAATTAATACAGAAGGCAAATGG - Intronic
1037143746 8:15548789-15548811 TTATTAAAACATAGGGTAGAAGG - Intronic
1038885767 8:31661285-31661307 TCATTAAAACAGATAAAAGGCGG - Intronic
1039446989 8:37640923-37640945 TCGTTAAAACAGAAATCAGAAGG + Intergenic
1039449600 8:37661406-37661428 TCAATAAAACAGAAGCCACAAGG + Intergenic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1041559445 8:59198412-59198434 TTAAGTAAACAGATGGCAGATGG + Intergenic
1042094250 8:65194914-65194936 TCCTTAAAAGAGGAGGCAGAGGG + Intergenic
1043016972 8:74951183-74951205 TCATCAAGACAGAATGCAGATGG - Intergenic
1043072414 8:75655577-75655599 TCAGTAATACAGATGGCCAACGG - Intergenic
1043647938 8:82546251-82546273 TAAGTAAAACAGAGGCCAGAAGG - Intergenic
1044235206 8:89822663-89822685 TAATTAAAATTGGTGGCAGAAGG - Intergenic
1044300835 8:90581138-90581160 TCCTTACAAGAGAAGGCAGAGGG - Intergenic
1044853136 8:96448497-96448519 TCATAAAAACAGATTACAAATGG - Intergenic
1045680303 8:104652213-104652235 TCATTTAAAGAGCTTGCAGAAGG + Intronic
1045702808 8:104886384-104886406 TGTTTAGAAAAGATGGCAGAAGG + Intronic
1045748829 8:105457505-105457527 TAATTAAAACACATGGCTGCAGG + Intronic
1047627393 8:126670035-126670057 TCATTGATTCAGAAGGCAGAGGG - Intergenic
1049981467 9:907970-907992 TCAGTACCACTGATGGCAGATGG + Intronic
1050269281 9:3924988-3925010 TCATTAAAACACCTGTCAGAGGG + Intronic
1050413188 9:5387296-5387318 TTCTTAAAACAGAGGTCAGATGG - Intronic
1050963211 9:11764888-11764910 TCATGAAAATAGAGAGCAGAAGG + Intergenic
1051713702 9:19959316-19959338 TCAATCAATCAGATGCCAGATGG + Intergenic
1053254191 9:36601756-36601778 TCATAGAGACAGAAGGCAGAAGG - Intronic
1055506037 9:76950373-76950395 TAATTAAAACATATAGAAGAGGG - Intergenic
1055835319 9:80433300-80433322 ATATGAAAACAGATGCCAGAAGG + Intergenic
1056798489 9:89675233-89675255 TCATTATCCCAGACGGCAGATGG - Intergenic
1056852184 9:90093952-90093974 CCATTAACACTGATGCCAGAGGG + Intergenic
1057337974 9:94171989-94172011 TCATTAAAAGTTATGGCAAATGG - Intergenic
1061314038 9:129783006-129783028 GCATTAAAACAGATGCCAACAGG - Intergenic
1186529295 X:10279112-10279134 TGACTAATACAGATGGCAAATGG - Intergenic
1189357160 X:40318820-40318842 TCAGGAAAACAGATGGCACTTGG + Intergenic
1194307779 X:92269993-92270015 TGATTAAAAGAGATCACAGAAGG - Intronic
1195799943 X:108697186-108697208 ACATTAAAACAGGGGGCATATGG - Exonic
1195909992 X:109879408-109879430 TTATTAGAACAGAAGGCACAGGG + Intergenic
1196676789 X:118428582-118428604 TTATTAAAACAAATGGAAGAGGG + Intronic
1198081619 X:133245462-133245484 ACATTATAACAGATCTCAGATGG - Intergenic
1198379535 X:136070849-136070871 CTATTTAAAGAGATGGCAGAAGG + Intergenic
1199141265 X:144316110-144316132 TCATTAAAATAAATTGAAGAGGG + Intergenic
1199577031 X:149322242-149322264 TCATTAATAGAGAGTGCAGAAGG + Intergenic
1200866313 Y:8047442-8047464 TCATCATAACAGATGGATGAAGG + Intergenic
1200900832 Y:8430218-8430240 TCATTATAACAGACGGATGAAGG - Intergenic
1201073838 Y:10172049-10172071 TGAGTCAAACAGATGGCAGAGGG - Intergenic
1201264164 Y:12190011-12190033 TCATTAAAAAAGAAAACAGAGGG + Intergenic
1201681938 Y:16655630-16655652 TCATTATAACTGATGTGAGATGG + Intergenic