ID: 1150676982

View in Genome Browser
Species Human (GRCh38)
Location 17:67252665-67252687
Sequence AAATTTATACAGAGAGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150676979_1150676982 5 Left 1150676979 17:67252637-67252659 CCACTTATATGAGGTTCCTACAG 0: 2
1: 24
2: 176
3: 695
4: 1410
Right 1150676982 17:67252665-67252687 AAATTTATACAGAGAGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150676982 Original CRISPR AAATTTATACAGAGAGTAGA AGG Intergenic
No off target data available for this crispr