ID: 1150678327

View in Genome Browser
Species Human (GRCh38)
Location 17:67263977-67263999
Sequence GTGTTCCAACGCAAGATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150678327_1150678333 30 Left 1150678327 17:67263977-67263999 CCTTTTATCTTGCGTTGGAACAC No data
Right 1150678333 17:67264030-67264052 CTCCCTCCTTGATTTTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150678327 Original CRISPR GTGTTCCAACGCAAGATAAA AGG (reversed) Intergenic
No off target data available for this crispr