ID: 1150678337

View in Genome Browser
Species Human (GRCh38)
Location 17:67264037-67264059
Sequence CTTGATTTTCAGATGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150678330_1150678337 -1 Left 1150678330 17:67264015-67264037 CCCAATATCCATTCTCTCCCTCC No data
Right 1150678337 17:67264037-67264059 CTTGATTTTCAGATGGAACATGG No data
1150678332_1150678337 -9 Left 1150678332 17:67264023-67264045 CCATTCTCTCCCTCCTTGATTTT No data
Right 1150678337 17:67264037-67264059 CTTGATTTTCAGATGGAACATGG No data
1150678329_1150678337 0 Left 1150678329 17:67264014-67264036 CCCCAATATCCATTCTCTCCCTC No data
Right 1150678337 17:67264037-67264059 CTTGATTTTCAGATGGAACATGG No data
1150678331_1150678337 -2 Left 1150678331 17:67264016-67264038 CCAATATCCATTCTCTCCCTCCT No data
Right 1150678337 17:67264037-67264059 CTTGATTTTCAGATGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150678337 Original CRISPR CTTGATTTTCAGATGGAACA TGG Intergenic
No off target data available for this crispr