ID: 1150679613

View in Genome Browser
Species Human (GRCh38)
Location 17:67274252-67274274
Sequence TCCAGCTGGTCTGAAACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150679607_1150679613 30 Left 1150679607 17:67274199-67274221 CCTGGCTAATTTTTTCTTGTATT 0: 15
1: 2142
2: 3143
3: 15528
4: 105611
Right 1150679613 17:67274252-67274274 TCCAGCTGGTCTGAAACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150679613 Original CRISPR TCCAGCTGGTCTGAAACTCC TGG Intergenic
No off target data available for this crispr