ID: 1150682248

View in Genome Browser
Species Human (GRCh38)
Location 17:67293429-67293451
Sequence CTCCAAGACAAGAGCAGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150682248_1150682254 -1 Left 1150682248 17:67293429-67293451 CCTCCGCTGCTCTTGTCTTGGAG No data
Right 1150682254 17:67293451-67293473 GATGACGCCAACCTTGGGGGAGG No data
1150682248_1150682252 -5 Left 1150682248 17:67293429-67293451 CCTCCGCTGCTCTTGTCTTGGAG No data
Right 1150682252 17:67293447-67293469 TGGAGATGACGCCAACCTTGGGG No data
1150682248_1150682251 -6 Left 1150682248 17:67293429-67293451 CCTCCGCTGCTCTTGTCTTGGAG No data
Right 1150682251 17:67293446-67293468 TTGGAGATGACGCCAACCTTGGG No data
1150682248_1150682253 -4 Left 1150682248 17:67293429-67293451 CCTCCGCTGCTCTTGTCTTGGAG No data
Right 1150682253 17:67293448-67293470 GGAGATGACGCCAACCTTGGGGG No data
1150682248_1150682250 -7 Left 1150682248 17:67293429-67293451 CCTCCGCTGCTCTTGTCTTGGAG No data
Right 1150682250 17:67293445-67293467 CTTGGAGATGACGCCAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150682248 Original CRISPR CTCCAAGACAAGAGCAGCGG AGG (reversed) Intergenic
No off target data available for this crispr