ID: 1150694124

View in Genome Browser
Species Human (GRCh38)
Location 17:67389564-67389586
Sequence TGCCATTTAAAAATAGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 441}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150694121_1150694124 8 Left 1150694121 17:67389533-67389555 CCTAGGCCAGAGGACACTGGAGA 0: 1
1: 0
2: 0
3: 57
4: 741
Right 1150694124 17:67389564-67389586 TGCCATTTAAAAATAGATGATGG 0: 1
1: 0
2: 2
3: 47
4: 441
1150694113_1150694124 26 Left 1150694113 17:67389515-67389537 CCCTGCCCTCCTGAAGCTCCTAG 0: 1
1: 1
2: 5
3: 94
4: 615
Right 1150694124 17:67389564-67389586 TGCCATTTAAAAATAGATGATGG 0: 1
1: 0
2: 2
3: 47
4: 441
1150694117_1150694124 20 Left 1150694117 17:67389521-67389543 CCTCCTGAAGCTCCTAGGCCAGA 0: 1
1: 0
2: 0
3: 20
4: 211
Right 1150694124 17:67389564-67389586 TGCCATTTAAAAATAGATGATGG 0: 1
1: 0
2: 2
3: 47
4: 441
1150694119_1150694124 17 Left 1150694119 17:67389524-67389546 CCTGAAGCTCCTAGGCCAGAGGA 0: 1
1: 0
2: 3
3: 10
4: 210
Right 1150694124 17:67389564-67389586 TGCCATTTAAAAATAGATGATGG 0: 1
1: 0
2: 2
3: 47
4: 441
1150694114_1150694124 25 Left 1150694114 17:67389516-67389538 CCTGCCCTCCTGAAGCTCCTAGG 0: 1
1: 0
2: 1
3: 42
4: 372
Right 1150694124 17:67389564-67389586 TGCCATTTAAAAATAGATGATGG 0: 1
1: 0
2: 2
3: 47
4: 441
1150694123_1150694124 2 Left 1150694123 17:67389539-67389561 CCAGAGGACACTGGAGAGGTTTT 0: 1
1: 0
2: 2
3: 16
4: 208
Right 1150694124 17:67389564-67389586 TGCCATTTAAAAATAGATGATGG 0: 1
1: 0
2: 2
3: 47
4: 441
1150694116_1150694124 21 Left 1150694116 17:67389520-67389542 CCCTCCTGAAGCTCCTAGGCCAG 0: 1
1: 0
2: 2
3: 31
4: 257
Right 1150694124 17:67389564-67389586 TGCCATTTAAAAATAGATGATGG 0: 1
1: 0
2: 2
3: 47
4: 441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150694124 Original CRISPR TGCCATTTAAAAATAGATGA TGG Intronic
901337082 1:8459388-8459410 TGTCATTTAAAACTGGAGGAAGG + Intronic
901968269 1:12885921-12885943 TGCCATTTTAAAATTCTTGAAGG - Intronic
901976088 1:12945131-12945153 TGCCATTTTAAAATTCTTGAAGG - Intronic
901976353 1:12947297-12947319 TGCCATTTTAAAATTCGTGAAGG - Intronic
901983674 1:13056190-13056212 TGCCATTTTAAAATTCTTGAAGG - Intronic
901998412 1:13172734-13172756 TGCCATTTTAAAATTCTTGAAGG + Intergenic
902008819 1:13254473-13254495 TGCCATTTTAAAATTCGTGAAGG + Intronic
902009084 1:13256634-13256656 TGCCATTTTAAAATTCTTGAAGG + Intronic
902016903 1:13315861-13315883 TGCCATTTTAAAATTCTTGAAGG + Intronic
902128275 1:14236238-14236260 TGCCAGATAAAACCAGATGAAGG - Intergenic
904414212 1:30346279-30346301 GGCCATACAAAAACAGATGATGG + Intergenic
905169924 1:36103755-36103777 TGCATTTTAAATAGAGATGAGGG + Intronic
905590915 1:39162541-39162563 TGCCATGGCAACATAGATGAGGG - Intronic
905908828 1:41639957-41639979 GGGCATTTAAAAATAGAGAATGG + Intronic
906877432 1:49554490-49554512 TTCCATTTGCAAATAGATCAAGG + Intronic
908662526 1:66452468-66452490 GGCCATTGAAAAAGGGATGATGG + Intergenic
909122623 1:71623343-71623365 TGCCATGTCAAAATAAATGGCGG - Intronic
910617269 1:89212861-89212883 TGCCCTTTTAAAAGAGCTGAAGG + Intergenic
910941622 1:92541307-92541329 TCCAATTTAAAAATAGGCGAAGG + Intronic
911705886 1:101012203-101012225 TGCCTTTTAAGAACTGATGACGG - Intronic
912010204 1:104950100-104950122 TGCCAATTACAAATAGATGTTGG + Intergenic
912031256 1:105247352-105247374 TGACATTTACAAACATATGAAGG - Intergenic
912088044 1:106034644-106034666 TGCTATGCAAAAATAGATGTTGG + Intergenic
912227872 1:107756161-107756183 AGACATTTTAAAATAGGTGAAGG - Intronic
912285984 1:108369940-108369962 TGCAATTTTAAAGTAGATAAAGG - Intergenic
912339041 1:108892186-108892208 TACTATTTAAGAATAAATGATGG - Intronic
913352226 1:117874549-117874571 GGCCACATAAAAATGGATGAAGG + Intronic
913471079 1:119187264-119187286 TCCCATTAAAAAGTAGATAAAGG - Intergenic
914319827 1:146548445-146548467 GGGCTTTTAAAAATAGAAGAAGG + Intergenic
914438933 1:147685610-147685632 TGCCCTTATAAAAGAGATGAAGG + Intergenic
916772433 1:167924795-167924817 TGCCATATAAAAATATTTTAGGG + Intronic
917852163 1:179074109-179074131 TGCCATTTAAAAATAGTTACAGG - Exonic
918974862 1:191470808-191470830 TGCCACTTAAAAATATCTCAAGG - Intergenic
919557014 1:199069978-199070000 AGATATTTAAAAATATATGAAGG + Intergenic
919674998 1:200372799-200372821 TGCCTTTTAAAAAGTGAAGATGG - Intergenic
920115614 1:203618750-203618772 TGCCATTTAAAAATAGTTTTTGG - Intergenic
921539641 1:216398122-216398144 TACCATTTTAAAATAGCTGTTGG - Intronic
921624613 1:217364632-217364654 TGACATTTGATAATAGATCAGGG + Intergenic
923060478 1:230467637-230467659 TGCCATTAAAAAAGAAATGAGGG - Intergenic
923685657 1:236151723-236151745 TGCCATTTAAAAATCGAGGAGGG - Intronic
924310888 1:242741996-242742018 TGCTATTTAAAATAAGTTGATGG - Intergenic
924561360 1:245158277-245158299 TCTCATTTAAAAAAAGAGGAGGG + Intronic
1063140174 10:3249385-3249407 TGCAATTTAAAAATTGTTAAAGG + Intergenic
1063330353 10:5152521-5152543 TGCAATTTAAAAATACTTCAAGG + Intergenic
1063726902 10:8647250-8647272 TGCCATTTGAAAATTTAAGATGG + Intergenic
1063760402 10:9067918-9067940 TGCCATATAAAAAGAAATGATGG - Intergenic
1064499100 10:15949391-15949413 TGCCTTTAAAGAATAGATCACGG + Intergenic
1064579092 10:16775388-16775410 TTCCATTTAAAAATATATTGTGG + Intronic
1064763630 10:18648038-18648060 TGACATAAAAAAATAGATGTTGG - Intronic
1064812194 10:19212779-19212801 AGCTATTTAAAAATAGATAGTGG + Intronic
1065766050 10:29030603-29030625 TGCAATTTGAAAATAAATCAGGG - Intergenic
1065766857 10:29038215-29038237 TGCCCTTCAAAAATAAGTGATGG - Intergenic
1066172539 10:32866415-32866437 ATCAATTTAAAAATAGTTGAGGG + Intronic
1066318999 10:34281012-34281034 TACCATTTAAAAATACATGGAGG + Intronic
1068780711 10:60916561-60916583 TGACATTTAAAAATAAATAGAGG - Intronic
1068878217 10:62020366-62020388 TGCCTTTTAAACACAGATGGGGG - Intronic
1069088733 10:64173752-64173774 TGCCCTTTTAAAAAAGATCATGG + Intergenic
1069241655 10:66147513-66147535 TAGCCTTTAAAAATAAATGAGGG - Intronic
1069705629 10:70457654-70457676 TACCATTTAAAAATAAACGTTGG + Intergenic
1072381832 10:94880074-94880096 TGCTATTAAGAAATAGTTGAGGG - Intergenic
1072924715 10:99607022-99607044 TGCCATTTATACTGAGATGATGG - Intergenic
1073569841 10:104570767-104570789 TGCCCTTTAAGAAATGATGAAGG - Intergenic
1074352419 10:112750724-112750746 TTTCATTAAAAAATAAATGAGGG - Intronic
1074683275 10:115932600-115932622 TTCCATATAAAACTAGATCATGG - Intronic
1075488270 10:122845373-122845395 TGCAACTTAAAAAAAAATGATGG - Intronic
1077574084 11:3366510-3366532 TTTGATTTAAAAATAGATGAAGG + Intronic
1078393795 11:10959820-10959842 GGCAATTAAAAAATATATGAAGG + Intergenic
1079507040 11:21164650-21164672 TGGCTTTTAAAAATAGAGTAAGG + Intronic
1081741490 11:45444186-45444208 GGCCATTTAAAAAAAGAAGATGG + Intergenic
1083194430 11:61075734-61075756 TGCTATTTAAAAATGTATGTTGG + Intergenic
1083754972 11:64787331-64787353 TGCCCTTTAAAAATATATCCTGG - Intergenic
1084143790 11:67252360-67252382 TGCCATTTTAATACAGATGAAGG + Intronic
1085312213 11:75523560-75523582 TGCCACTTTAAAATAGGTTATGG - Intronic
1085914495 11:80869025-80869047 CTCCAGTTGAAAATAGATGATGG + Intergenic
1085919039 11:80929497-80929519 TAGAATTTAAAAATAGATCAGGG - Intergenic
1086161994 11:83732347-83732369 AGACATTTAAGAATAGTTGAAGG - Intronic
1086245293 11:84744583-84744605 TTCAATTTTAAAATAGATTAAGG - Intronic
1088010788 11:104998582-104998604 CACCATGTAAACATAGATGATGG - Intronic
1088158201 11:106835204-106835226 AGCCAATTAAAAACTGATGAGGG + Intronic
1088586187 11:111361944-111361966 TGTCATTTAGAAATAGCTGAAGG - Intronic
1088712614 11:112522107-112522129 TGACATTTAAAAAAAGGAGAAGG + Intergenic
1091523130 12:1268272-1268294 TGCCATTTAATAAACAATGAGGG - Intronic
1092805728 12:12220309-12220331 TCCCTTTTAAAACTGGATGAAGG - Intronic
1092937899 12:13380727-13380749 TGCCTTTTAAAAAGACATGGAGG - Intronic
1093946300 12:25113598-25113620 TTGCTTTTAAAACTAGATGAGGG - Intronic
1095248687 12:39953303-39953325 TTCCTGTTAAAAATAAATGATGG + Intronic
1097124080 12:56759574-56759596 TGGCATTTAAACAAATATGATGG - Intronic
1097585645 12:61512953-61512975 AACCATTTATAAAAAGATGAAGG - Intergenic
1098584436 12:72139235-72139257 TGCCATTTAAAATTTGGTGGTGG - Intronic
1098745022 12:74225120-74225142 GGCCATTTAAATAAAGATAATGG + Intergenic
1098885794 12:75959677-75959699 TGCAATTTATAAATAAATGTTGG + Intergenic
1098985870 12:77011410-77011432 TGTAATTTAAAAATAGCTGATGG - Intergenic
1099133882 12:78868705-78868727 TACCATTTAAAGAAAGATGACGG + Intronic
1099300299 12:80885496-80885518 TGCAATTTAAATATTGATCAGGG + Intronic
1099450007 12:82797154-82797176 TGCCATTTTAAAAAACATAATGG + Intronic
1100216150 12:92450822-92450844 TGCAATTGAAAAATAAATCAGGG + Intergenic
1100754079 12:97731053-97731075 TGCCATGTAAAAATAAATAATGG - Intergenic
1100942110 12:99734868-99734890 TGTCATTTAAAACTAGAGAAAGG - Intronic
1101427694 12:104601234-104601256 TGCCATTTAAAAAGAGCTCTTGG + Intronic
1101536311 12:105620148-105620170 ATCCAATTAAAAATGGATGAAGG - Intergenic
1105451812 13:20506816-20506838 GGCCATATAAAAATAGGAGATGG - Intronic
1105582167 13:21708558-21708580 TGCCATCTGGAGATAGATGAGGG + Intergenic
1107170513 13:37337079-37337101 AGGCAATTATAAATAGATGATGG + Intergenic
1107253131 13:38390360-38390382 CTCCACTTAAAAATACATGATGG - Intergenic
1107784085 13:43937058-43937080 GGCCATTTCAAAATCCATGACGG - Intergenic
1107934607 13:45334957-45334979 TGACATTTGAAAACAAATGAAGG - Exonic
1108034617 13:46276133-46276155 AACCATTTAAAAATACATTATGG + Intronic
1109022734 13:57119102-57119124 TTCCATTTAAGAAAAGAGGAGGG - Intergenic
1110149786 13:72237478-72237500 TGCCATTTAAAAAAATATGTAGG - Intergenic
1110259985 13:73474219-73474241 TGGCATTTAAAATTAAATGAAGG + Intergenic
1110895189 13:80741716-80741738 GGCCATTTAATAATAGATCCTGG + Intergenic
1111287985 13:86120176-86120198 GGCCATTTAAAAATATGTCAAGG + Intergenic
1111495145 13:89038106-89038128 TGCCATTTATATATATATGTGGG - Intergenic
1111690210 13:91554782-91554804 GGCCTTTTAAAATTAGATGTGGG - Intronic
1112131179 13:96525237-96525259 TTCTATTTAAAAATAGATGGGGG + Intronic
1112144520 13:96682724-96682746 TGATATTTTAAAATAAATGATGG + Intronic
1112473475 13:99710214-99710236 CACCATTTAAAAATAGGTAAGGG - Intronic
1112641980 13:101285563-101285585 TGTCATTTAAAAATACATATAGG - Intronic
1112883632 13:104140593-104140615 TTCCATTTAATTATATATGAAGG - Intergenic
1113222281 13:108118811-108118833 TGTAATTTAAAAAGAGATAATGG - Intergenic
1113289420 13:108888530-108888552 TGTCATTTACAAATAGGGGAGGG + Intronic
1113637668 13:111931203-111931225 GGTCATTTAAAAAGAGATGGTGG - Intergenic
1113670223 13:112171061-112171083 TGACCTTTAGAAATAGAAGAGGG + Intergenic
1114698669 14:24653335-24653357 TGAAATTTAAAAATAAAGGAAGG + Intergenic
1114894253 14:26966372-26966394 TTGCATTTAACAAAAGATGAGGG - Intergenic
1115173668 14:30537308-30537330 TTCAATTTAAAAATAGACAAGGG - Intergenic
1115401452 14:32965817-32965839 CGCCATTTAAAAATAGCTGTTGG + Intronic
1116197476 14:41747825-41747847 GCCAATTCAAAAATAGATGAAGG + Intronic
1116330347 14:43588119-43588141 TGCATTTTAAAAATATATGTTGG + Intergenic
1116552607 14:46261039-46261061 AGCCATTTAGAAATAAAAGATGG - Intergenic
1116675437 14:47901163-47901185 TAACATTTAAAAATTTATGAAGG + Intergenic
1116679247 14:47944830-47944852 GGCCATTTAAAAATTTATAAAGG + Intergenic
1117475864 14:56094517-56094539 TGCTATTGAAAATTAGAGGACGG + Intergenic
1117838154 14:59829108-59829130 TGCCTTTTAAGTATAAATGATGG - Intronic
1118534659 14:66747262-66747284 TACCATTTAAAAATCAATTAGGG - Intronic
1119801575 14:77449904-77449926 TGCCATTAAAAAATGGAGCAGGG + Intronic
1119865757 14:77972335-77972357 TGTCATTAAAAAAATGATGAAGG + Intergenic
1120977269 14:90260018-90260040 TACCACCTGAAAATAGATGATGG + Intronic
1121334943 14:93071649-93071671 TGTAATTTAAAAATGGATGATGG - Intronic
1123395161 15:19926642-19926664 AGCCATTTTGAAATATATGAAGG + Intergenic
1126419985 15:48461932-48461954 GGCCATTCAAAAGTAGATGGTGG + Intronic
1126610683 15:50526515-50526537 TGCCATTTCCAAATATTTGAAGG + Intronic
1126915540 15:53462054-53462076 TTACATTTAAAAATACGTGAAGG - Intergenic
1127282633 15:57504920-57504942 TTCCTTTTTAAAACAGATGAGGG + Intronic
1127594686 15:60467951-60467973 TTCCATTTTAAAAAAAATGACGG + Intronic
1130804331 15:87302772-87302794 TGTAATTGAAATATAGATGAAGG - Intergenic
1131022495 15:89110846-89110868 TGCTATTTAAAAAAAGTTGTGGG + Intronic
1132094259 15:98970344-98970366 TTTCATTTAAAAAAAGATGCAGG - Intronic
1132136066 15:99340312-99340334 TGCCATTTACAAAAAGAGAAGGG - Intronic
1133903889 16:10003182-10003204 GGCCACTCAAAAATAGATGAAGG - Intronic
1133945910 16:10348250-10348272 TCCAATTTAAAAATAGGCGAAGG - Intronic
1134593898 16:15480050-15480072 GGCCATTTAAAAAAATATGGAGG - Intronic
1134813095 16:17183914-17183936 ACCCTTTTAAAAATTGATGAGGG - Intronic
1135925752 16:26692533-26692555 TGCCCTTTTAAAATATATTATGG + Intergenic
1136558105 16:31020669-31020691 TGCCATGTAATAATACAAGAAGG + Intergenic
1138888784 16:61115260-61115282 GGCCTTTGAAAAATAGGTGAGGG + Intergenic
1139458445 16:67103039-67103061 TGCCATATATGAATATATGATGG - Intergenic
1139666257 16:68458889-68458911 TTCCAATTAAAAATTGATGGAGG - Intergenic
1140013701 16:71161632-71161654 GGGCTTTTAAAAATAGAAGAAGG - Intronic
1140256522 16:73341372-73341394 GGCCAATAAAAAATGGATGAAGG + Intergenic
1140311180 16:73850031-73850053 TTCCTTTTAAAAATAAATGCTGG - Intergenic
1140795169 16:78430593-78430615 GGCAATTTGAAAATATATGACGG - Intronic
1141322307 16:83022996-83023018 TACCATCTAAAAATGGATAAGGG - Intronic
1142441208 16:90098631-90098653 TGCAATTTACCAAAAGATGAAGG + Intergenic
1144135451 17:12290762-12290784 TGACATTTAAAAGCAGATAAAGG - Intergenic
1146117865 17:30158286-30158308 TGCCATTAAAAAGTGGGTGAAGG - Intronic
1146237046 17:31176333-31176355 CCCCATTAAAAAGTAGATGAAGG - Intronic
1148586078 17:48781623-48781645 TGCAATTTAAAAATAGACAAAGG - Intronic
1149142332 17:53447370-53447392 TGGAATTTAAAAATATATGCAGG - Intergenic
1150694124 17:67389564-67389586 TGCCATTTAAAAATAGATGATGG + Intronic
1151769339 17:76149731-76149753 TGCCAATTAAAAACAAATCATGG + Intronic
1153980683 18:10306742-10306764 TCCCATTTAAATATAGAAAAGGG - Intergenic
1154334242 18:13453156-13453178 TGCCCTTTGAAAACAGATGATGG + Intronic
1154937489 18:21076145-21076167 TGCCATTTAAACATCACTGATGG + Intronic
1155428771 18:25733801-25733823 TGCCATTTAAACAAAAATGCTGG - Intergenic
1155697966 18:28706536-28706558 TGCCATTGATGCATAGATGAAGG + Intergenic
1156127143 18:33919889-33919911 GAGCATTTAAAAATAGATGGGGG + Intronic
1157458717 18:47864020-47864042 TGACATTTAAAAGTGAATGATGG - Intronic
1157562697 18:48659890-48659912 TGTCATTTAAATATGGATGTAGG + Intronic
1157562739 18:48660142-48660164 TGGCATTTAAATATGGATGTAGG + Intronic
1157637191 18:49170179-49170201 CCCCTTTTATAAATAGATGATGG + Intronic
1158691510 18:59665418-59665440 TCCCATTTAAAAATAAGTGTTGG + Intronic
1158978402 18:62734733-62734755 TGTTATTTAATAATAGATGGTGG - Intronic
1159260918 18:66011580-66011602 ATCCAATAAAAAATAGATGAAGG + Intergenic
1159324856 18:66901711-66901733 TGCATTTTAAAAATATTTGAAGG + Intergenic
1159446150 18:68544150-68544172 GTCCATTTAAACCTAGATGACGG + Intergenic
1161986042 19:7654929-7654951 TTCCGCTTAAAAATACATGAGGG + Intergenic
1162599340 19:11655699-11655721 CCCCATTAAAAAATAGGTGAAGG + Intergenic
1165661115 19:37580975-37580997 TGGTATTTAAACATAGATGCTGG - Intronic
1166007782 19:39918958-39918980 TGCCATTTAAAAAGGGGTGTAGG - Intronic
926210687 2:10867479-10867501 TGGCCTTTAAGAAGAGATGAAGG - Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927013347 2:18929479-18929501 AGCTATTTAAAACTAGATGATGG + Intergenic
927102933 2:19801666-19801688 TGCCAGTTAAAAAAAAAAGATGG - Intergenic
928341759 2:30448799-30448821 TGCCACTTAAAAATATCTTAGGG + Intronic
929061251 2:37926462-37926484 TGACATTTTAATATAGATTATGG - Intronic
929182811 2:39061686-39061708 TTCTTTTTAAAAATACATGAAGG - Intronic
932136069 2:69229880-69229902 TGCCATTGATGAAGAGATGATGG + Intronic
933073356 2:77890622-77890644 TTCCATTTAAAAATAAAGAATGG - Intergenic
933254768 2:80068437-80068459 TTCCAGTTAAAGAGAGATGAAGG - Intronic
934982852 2:98860917-98860939 TCCCATTTAAAAACAGACAAAGG + Intronic
935273272 2:101453335-101453357 TGCCATTTAAATCTCGATGTTGG + Intronic
935529779 2:104218240-104218262 TGACACTTAGAAACAGATGAAGG + Intergenic
936158437 2:110065255-110065277 TTCCATTAAAAAGTAGATGAAGG - Intergenic
936186224 2:110306067-110306089 TTCCATTAAAAAGTAGATGAAGG + Intergenic
936752009 2:115654672-115654694 ATTCATTTAAAAATAGATGTAGG - Intronic
936775953 2:115973443-115973465 TGATATTTAAAAGTTGATGAGGG - Intergenic
937460129 2:122078348-122078370 TCCCATTTGAAAATTGAAGAGGG - Intergenic
937460474 2:122081179-122081201 TGCCATTAAAGGATAGATAAAGG + Intergenic
937598471 2:123699011-123699033 TGCCAGTTATAAATAGTTGCTGG + Intergenic
937793758 2:125992593-125992615 TGCCATTTAAAAAAAAATTCTGG + Intergenic
939310069 2:140464408-140464430 AGCAATTTAAAAATAGGTAAGGG - Intronic
939452511 2:142392661-142392683 TGCATTTTAAAAATATATGGAGG + Intergenic
939951908 2:148485430-148485452 TAAAATCTAAAAATAGATGAAGG + Intronic
940057445 2:149527598-149527620 TGACATTGTAAAATAGCTGAAGG + Intergenic
940690320 2:156909777-156909799 TGGCACTGAAAAATAAATGATGG - Intergenic
940709674 2:157146384-157146406 TGCTTTTTAAAAAGAGAAGAAGG + Intergenic
941332361 2:164194552-164194574 TTCCTTTTAAAGATATATGATGG + Intergenic
941528085 2:166630863-166630885 TGGCATTAAAAAAAAGATAAAGG - Intergenic
941824971 2:169884997-169885019 TGCCATTTAAATATTCATTAAGG + Intronic
941865138 2:170326583-170326605 TGCCATGTCAATAGAGATGATGG - Intronic
942710540 2:178830291-178830313 TTGAATTTAAAAATAGATGCTGG - Exonic
943032275 2:182700269-182700291 TCCCATTTAAAAAAATATGTAGG + Intergenic
943362712 2:186941682-186941704 TAACTTTTAAAAATAAATGATGG - Intergenic
943660124 2:190550638-190550660 TGCTATTAAAAAATAGAGAAGGG - Intergenic
943704338 2:191019192-191019214 TGTCATTTTGAAATAGATCAAGG - Intronic
943894790 2:193342534-193342556 AAACATTTAAAAATAAATGAAGG - Intergenic
943901855 2:193449341-193449363 TACCATTTAAACAAAAATGACGG + Intergenic
944162694 2:196681788-196681810 TCCCTTTTAAAAATAGACAAAGG - Intronic
945133298 2:206598030-206598052 TCCCTTTTAGAAATAGAAGAAGG - Intronic
945249136 2:207748565-207748587 TGGCATTTAGAAAAATATGAAGG + Intronic
945914036 2:215683600-215683622 AGCCCTTTGAACATAGATGATGG - Intergenic
946684414 2:222253046-222253068 GGCCATTTAGATAGAGATGATGG - Intronic
946749732 2:222881866-222881888 TGCCTGTTAAATATAGAGGATGG + Intronic
947022417 2:225694580-225694602 TGCTATTTAAAAATAAATGTGGG + Intergenic
947205956 2:227661343-227661365 TGCCATTTAAGAATATCAGAAGG - Intergenic
949024758 2:241761814-241761836 TGGCATGGAAAAATAGGTGACGG + Intronic
1169416524 20:5421678-5421700 TCCCATTAAAAAATAGACAAAGG + Intergenic
1170213277 20:13866795-13866817 TGCCAGGTAAAAATATTTGAAGG + Exonic
1170264833 20:14454131-14454153 TGCAATTTAAAATAAGAAGATGG - Intronic
1170335285 20:15264014-15264036 TGCCATTTAAAAAGTCCTGATGG - Intronic
1170510577 20:17072329-17072351 TGCCAAACAAAAATAGATGCTGG + Intergenic
1170662771 20:18359048-18359070 AGGCATTTAAAAATAGACAATGG + Intergenic
1170687236 20:18580474-18580496 TGCTTTTTAAAAATAAATTAAGG - Intronic
1171106386 20:22437203-22437225 TGCCAACTAAAAATAAAAGAGGG - Intergenic
1172994654 20:39061141-39061163 TACATGTTAAAAATAGATGAAGG - Intergenic
1173948477 20:46970736-46970758 TTCCATTTAAAAATACATCCTGG - Intronic
1174750381 20:53105947-53105969 TGCCAATTAAAAATAAAATAAGG - Intronic
1176012773 20:62908695-62908717 TGACAATTAAAAAAAGATGTTGG + Intronic
1176036255 20:63038717-63038739 TTCCATTTAAAAATAGGCAAAGG - Intergenic
1177582784 21:23049155-23049177 TGCCATGTAGATATATATGAAGG - Intergenic
1182139401 22:27940152-27940174 TACCTGTTAAAGATAGATGATGG - Intergenic
1182215566 22:28714459-28714481 TGCCATTTAAAAATGGGCAAAGG - Intronic
1182568402 22:31216911-31216933 TACTATATAAAAATAGATAAAGG - Intronic
1182969662 22:34561487-34561509 TGCCTTTTAAAAATGGAAGTTGG - Intergenic
1183572150 22:38661533-38661555 TGTAATTTATAAATAAATGAAGG - Intronic
1183584674 22:38746034-38746056 TGCCACTTACAGAAAGATGAAGG - Intronic
1184096102 22:42317413-42317435 TTCGATTTAAACACAGATGACGG + Intronic
1184270337 22:43377596-43377618 TTCCATTTTAAGAAAGATGAGGG + Intergenic
1184350506 22:43940507-43940529 TTCCATTTAAAATCACATGAAGG + Intronic
1184397309 22:44250293-44250315 TGCCATTCCAAAATACATAATGG - Intronic
949107066 3:212254-212276 TGCTATATAAAAATAGACTATGG - Intronic
949939075 3:9140331-9140353 TGTCATTTAACAATATATTATGG - Intronic
950370784 3:12528415-12528437 TGGATTTTAAAAATAGATGATGG + Intronic
952063819 3:29542660-29542682 TTCCATTTAAAAATTGGGGATGG - Intronic
954037634 3:47860559-47860581 TGCAATTAAAGAATAGTTGAGGG + Intronic
954250182 3:49361428-49361450 TGCCTTTTTAAAAGTGATGATGG - Intronic
956923294 3:73953857-73953879 TGTCATTTAAAAATAGAAATTGG - Intergenic
957811140 3:85224422-85224444 TGCCATCAAAAAATGGGTGAAGG - Intronic
957941418 3:87009622-87009644 TCCCATTTAAAAATGGACAAAGG - Intergenic
957982682 3:87530595-87530617 TCCCATTTAAAAATTGTAGAAGG - Intergenic
958157852 3:89777599-89777621 TGCCATTAAAAAATGGACAAAGG - Intergenic
958194690 3:90228943-90228965 TACCTTTTAAAAATAGATTTAGG - Intergenic
958535113 3:95391195-95391217 TGCCATTTTTAAATAGAATATGG - Intergenic
959179355 3:102958759-102958781 TGCCTCATAAAAATATATGAAGG - Intergenic
959508906 3:107187576-107187598 AGCCATTTAAAAACTGATAAAGG + Intergenic
959937674 3:112046126-112046148 TGCAATTGAACAATAGATGTGGG + Intronic
960100838 3:113741465-113741487 CTGCATTTAAAAAAAGATGAAGG + Intronic
962473802 3:135738384-135738406 TTTCACTTAAAAATAGATGCTGG + Intergenic
962620872 3:137177225-137177247 TTCCTTTTAAAAATACATTAAGG + Intergenic
963574132 3:147038546-147038568 CCCCATTTAAAAATAGATAAAGG + Intergenic
964194671 3:154048721-154048743 TGTTATGTAATAATAGATGAAGG + Intergenic
964771035 3:160225027-160225049 TTCCGATTAAAAATAGATGATGG - Intergenic
965019278 3:163206521-163206543 TCCTACTTAAAAATATATGAGGG + Intergenic
965948535 3:174274446-174274468 GGCAATTGAAAAAAAGATGATGG - Intronic
965966362 3:174495191-174495213 AGCCATTTTAGAATAAATGAAGG + Intronic
966361507 3:179134922-179134944 TGCCATTTAAAAGTGGAGAAAGG + Intergenic
966439521 3:179928400-179928422 AGCCATTTACAAATGGCTGAGGG + Intronic
966651812 3:182309860-182309882 TACCCTTTATAAATAGGTGAGGG - Intergenic
967568743 3:191002521-191002543 GTCAATTTAAAAATAGATTAAGG - Intergenic
968361470 3:198149603-198149625 TGCAATTTACCAAAAGATGAAGG + Intergenic
969821643 4:9725282-9725304 TGCCATTAAAAAAAAGAAAAAGG - Intergenic
970152391 4:13103285-13103307 TTCCAATTAAAAATAGATAAAGG - Intergenic
971060558 4:22964022-22964044 TCCCATCAAAAAATGGATGAAGG - Intergenic
971181904 4:24336366-24336388 ATCCATTTAAAATTAGATGCTGG - Intergenic
971197189 4:24480789-24480811 TGCCATTTGAAGACAGATGATGG + Intergenic
971204090 4:24545707-24545729 TGCCATTTACAATTAGAACATGG - Intronic
971288851 4:25316640-25316662 ACCCAATTAAAAATAGATAAAGG - Intronic
971663886 4:29457216-29457238 TTCCATTTAAAAGTAGATTTTGG + Intergenic
971818790 4:31525291-31525313 CACCATTTAAAAGTAGGTGAAGG - Intergenic
972334888 4:38098889-38098911 TCCCAGTTAAAATTAGATGAGGG + Intronic
972411637 4:38801286-38801308 TGCCATATGAAAATACAAGAAGG + Intronic
972551411 4:40138256-40138278 TCCAATTTAAAAATAGACAAAGG - Intronic
972757707 4:42066143-42066165 TTAATTTTAAAAATAGATGAAGG - Intronic
973018153 4:45167245-45167267 GGCGCTTAAAAAATAGATGACGG - Intergenic
973076460 4:45933991-45934013 TACCACTTGAAAATAGAAGAGGG - Intergenic
974097258 4:57376961-57376983 TGCCATGTGAAGATAGATGTAGG - Intergenic
975385498 4:73754776-73754798 CCCCATTAAAAAATTGATGATGG + Intergenic
975774026 4:77764385-77764407 TCCCATTTAAAAAGAGAAAAGGG + Intronic
975929999 4:79509147-79509169 AGGCATTTAAACATATATGATGG - Intergenic
976029133 4:80729902-80729924 TTAAATTTAAAAATAGATGCTGG - Intronic
976480750 4:85541770-85541792 TGCCATAAAAAAACAGAAGAAGG + Intronic
977436294 4:96999800-96999822 ATCCATTAAAAAATAGATTATGG + Intergenic
978118946 4:105055102-105055124 TGCCATTTAAAAGTGGACAAAGG + Intergenic
978896762 4:113897679-113897701 TCCCAGAAAAAAATAGATGAGGG - Intergenic
979324499 4:119362865-119362887 TGCCATCTAAAACAAAATGAAGG + Intergenic
979401830 4:120258382-120258404 TATCATTTAAAAATAGAAAATGG - Intergenic
979581673 4:122368072-122368094 TGCAATTAAAAAAAAGATAAAGG + Intergenic
979889937 4:126078641-126078663 TGCCATTTCAAAATAGACTTTGG - Intergenic
980367518 4:131823707-131823729 AGACATTTAAAAAGAAATGAAGG + Intergenic
980519786 4:133916840-133916862 TGCCATTAAAAAGTAGGCGAAGG - Intergenic
981623596 4:146732172-146732194 TACTATTTGAAAATAGGTGATGG + Intronic
982477369 4:155870089-155870111 TTCCATTGTTAAATAGATGAGGG - Intronic
983021952 4:162687832-162687854 AGCCATTAAGAAATAGATCATGG + Intergenic
983033423 4:162832389-162832411 TTCAATTTAAAAATATATGGTGG + Intergenic
983093121 4:163529492-163529514 TTACATTTTAAAATAAATGAGGG - Intronic
984177495 4:176437403-176437425 AGCCATTTAAAGATACATGATGG - Intergenic
984604028 4:181763438-181763460 GGCCATATAAAAACAGATGTAGG - Intergenic
984991713 4:185387569-185387591 TGCAATTCAAAAAGACATGAGGG - Intronic
986374955 5:7121501-7121523 TTCCATTTAAAAACAGCTGTTGG - Intergenic
987633332 5:20505831-20505853 TGCCATTCAGAAATAGCTCAGGG - Intronic
988190073 5:27919025-27919047 GGACATTTAAAAATAGTTAAGGG + Intergenic
989030669 5:37115283-37115305 TGCCATTTGAAAAAAGAGTATGG - Intronic
989220939 5:38962679-38962701 TTCCATTTAAGGATAGATCAAGG + Intronic
989246153 5:39257194-39257216 TGCCTTTTAAAACTAGCTAATGG - Intronic
989371951 5:40719861-40719883 TGTAATTTAAAAATAGACAAAGG - Intronic
990080122 5:51902316-51902338 TGCCATTTAAAAAGTGTTGCAGG - Intergenic
990530554 5:56669458-56669480 TGTCAATTCAAAACAGATGAAGG + Intergenic
990855307 5:60260127-60260149 TCCCATTTAAAAATAGGTGGTGG - Intronic
991156917 5:63448304-63448326 TGTCCTTTAAAAAAATATGAAGG - Intergenic
991297622 5:65098682-65098704 TGCACTTTAAAGATAGAGGAAGG + Intergenic
991959386 5:72029058-72029080 ATCCAATTAAAAATGGATGAAGG - Intergenic
993306032 5:86276702-86276724 TGCAATTTTAAAGTAGATAAAGG - Intergenic
993374556 5:87135104-87135126 TGGCATTTAAAAATGAATAAAGG + Intergenic
993643225 5:90431547-90431569 TGCCTTTTAAAAATCTATGTGGG + Intergenic
993751556 5:91675252-91675274 GGCCTTTTAAAAAAAGATCAAGG - Intergenic
993781380 5:92069386-92069408 CACCATTTAAATATAGATTATGG + Intergenic
994056618 5:95423709-95423731 TGCCAGTGAAAAATAAAAGAAGG + Intronic
994260191 5:97649205-97649227 AGACATTTAAAAATAAAAGAAGG + Intergenic
994320991 5:98393876-98393898 TGACATTTAAAAAAATTTGAAGG - Intergenic
994430458 5:99653098-99653120 TACCATTTAAAAAAACCTGATGG + Intergenic
994783484 5:104123540-104123562 AGCCATTTAGAAACAAATGAAGG + Intergenic
995376255 5:111477442-111477464 TTCCATTTGAAAAAAAATGAGGG - Intronic
995604580 5:113838284-113838306 TTCAATTTAAAAATAGGTAAAGG - Intergenic
996020399 5:118584997-118585019 TGCATTTTTAAAACAGATGATGG + Intergenic
996092847 5:119367491-119367513 TGCCATTTAAAAAAATAGAAAGG - Intronic
996186247 5:120478908-120478930 TGACATTTAAAAATGGATATTGG + Intronic
996801926 5:127413773-127413795 TGCAATTTATAATTAGATGTAGG - Intronic
996820423 5:127620334-127620356 TGACATCTGAAAATAGATCATGG + Intergenic
998210268 5:140191786-140191808 TGTGATTTAAAAATAAATAATGG + Intronic
998566380 5:143219659-143219681 TGTCATTTACTAATAGAGGAGGG - Intronic
998672588 5:144370435-144370457 TGCCATCAAAAAATAAATAAAGG - Intronic
999884934 5:155911782-155911804 TGGCATGAAAAAATAGAGGATGG + Intronic
1000832674 5:166123014-166123036 TGCTATTGAAAAAAAGAGGATGG + Intergenic
1000889011 5:166782013-166782035 GGAAATTTAAAAATAGATCAAGG - Intergenic
1000917258 5:167097341-167097363 TGCCAATTAAATATTGGTGATGG - Intergenic
1004230737 6:13830979-13831001 TACCATCTGCAAATAGATGATGG + Intergenic
1004263435 6:14128775-14128797 TGCCATTTAAAAATAACTAGCGG + Intronic
1004951127 6:20673137-20673159 TTCTGTTTAAGAATAGATGATGG + Intronic
1004964021 6:20826494-20826516 TGCCATTTAAAAATAAAGAAGGG - Intronic
1005110422 6:22275356-22275378 AGCCAATAAACAATAGATGATGG - Intergenic
1005116079 6:22339108-22339130 TGCCAATTAAAAATTGACAAGGG + Intergenic
1005458415 6:26044075-26044097 TGCCCTTTCGAAAAAGATGACGG - Intergenic
1005777660 6:29153926-29153948 TGTCATTTTGAAATAGATGCTGG - Intergenic
1006880698 6:37336629-37336651 AGCCATGGAAAAAAAGATGATGG - Intergenic
1007497662 6:42271975-42271997 TGCGTTTTTAAAATGGATGACGG + Intronic
1008102499 6:47407050-47407072 TGGCATTAAAAAATTCATGAGGG - Intergenic
1008463775 6:51806673-51806695 CGTTATCTAAAAATAGATGAGGG + Intronic
1008723054 6:54380877-54380899 TGCCATATAAATATATATGAGGG - Intronic
1008770471 6:54972739-54972761 TGCCATTTAAAAAGAAGTGTAGG - Intergenic
1009654832 6:66528742-66528764 GGCCATTAATAGATAGATGATGG - Intergenic
1010383853 6:75255921-75255943 TGACTTCTAAAAATATATGACGG - Exonic
1010536219 6:77034504-77034526 TGCCATGTGAAAATAGGTAATGG - Intergenic
1011269791 6:85566251-85566273 TGCCATTTAACTAAAGCTGATGG - Intronic
1011743573 6:90387535-90387557 TGTCATTTAAAAATCCCTGAAGG - Intergenic
1011878373 6:91991708-91991730 TGACATATAAGCATAGATGAGGG + Intergenic
1012700003 6:102444085-102444107 TGAGATTAAAAAATACATGAAGG + Intergenic
1012759123 6:103275320-103275342 TGCTCTTTAAAAATAAATTAAGG - Intergenic
1012791252 6:103699539-103699561 TGTCATTTAAGAATAGAGAAGGG + Intergenic
1012792852 6:103722059-103722081 TGTGATTTAAAAATATATGTAGG - Intergenic
1012813125 6:103986053-103986075 TGCCTTTTAAAAATGGGTAAAGG + Intergenic
1013607367 6:111762643-111762665 GGCCATTTCAAAATACATCAGGG - Intronic
1013797127 6:113900420-113900442 TGTCATTAAAAAATATATGAGGG - Intergenic
1014235177 6:118946228-118946250 TTCCATTTAAAAATATAGAATGG + Intergenic
1014261898 6:119228474-119228496 TGCCATTCAAATATACATAATGG + Intronic
1014348546 6:120308779-120308801 TGGCACTAAAAAATAGAGGAGGG - Intergenic
1015189633 6:130458638-130458660 AGACATTTAAATCTAGATGAGGG - Intergenic
1015467561 6:133563902-133563924 TGCCCTTTAAAAATAGATTCTGG + Intergenic
1016444953 6:144121721-144121743 TCCAATTTAAAAATAGATAAAGG - Intergenic
1016636082 6:146292440-146292462 ATGCAATTAAAAATAGATGAAGG + Intronic
1017261386 6:152391689-152391711 TGCCTTTTAAATAAAGATGCTGG + Intronic
1017667246 6:156732159-156732181 TGCCATTTAAAGAAAAAGGAAGG + Intergenic
1020756039 7:12204054-12204076 CTCCTTTTAAAAATAGAGGAGGG - Intergenic
1021954288 7:25808589-25808611 TGCTATTTAAAAATAGAAAATGG - Intergenic
1022798829 7:33755623-33755645 TGCTGTTTAGAAATAGATCAAGG + Intergenic
1023301376 7:38775819-38775841 TGCCATTTAAAAAAAAAAAAAGG + Intronic
1023613037 7:41990840-41990862 TGGCAATTAAAAATAGATTAAGG + Intronic
1024402300 7:48939053-48939075 TGGTATCTAAAAACAGATGAAGG - Intergenic
1024450363 7:49533096-49533118 CCCCATTAAAAAGTAGATGAAGG - Intergenic
1024963543 7:55003154-55003176 TTCTATTAAAAAATAGATGGAGG - Intergenic
1025854012 7:65262966-65262988 TGCCATAGAAAAAAAGGTGATGG + Intergenic
1026370876 7:69697727-69697749 TGTAATTTAAAAATGGAGGAAGG - Intronic
1027470070 7:78562529-78562551 TGCTATTTATAAACAGTTGATGG + Intronic
1027565227 7:79783483-79783505 CTCTATTTAAAAATAGATAAAGG - Intergenic
1027712329 7:81620747-81620769 TGCCATCTTAATATATATGATGG - Intergenic
1028221172 7:88198755-88198777 TTTCATGTAAAAATAGGTGAGGG - Intronic
1029097637 7:98101583-98101605 GGCCCTTTAAAAATGAATGATGG - Intergenic
1030569160 7:111200544-111200566 TTACATTTAAAAATTGAGGAAGG + Intronic
1030912479 7:115268517-115268539 TTATATTTAAAAACAGATGAAGG + Intergenic
1030960465 7:115914130-115914152 TGCCATATGAAAAAAAATGAGGG - Intergenic
1031218338 7:118927726-118927748 TGCCATTTAAATCAAGTTGATGG - Intergenic
1032331202 7:130982066-130982088 TCTCATTAAAAAATACATGAAGG + Intergenic
1032370537 7:131346151-131346173 TTCACTTAAAAAATAGATGATGG + Intronic
1032861284 7:135882097-135882119 TCCCATTAAAAAATGGACGAAGG + Intergenic
1033381837 7:140828293-140828315 GGCCATACAAAAATAGATGGTGG + Intronic
1035580090 8:734301-734323 TGCCATTCAAAAATCACTGAAGG + Intronic
1036118794 8:5991544-5991566 CCTCATTTCAAAATAGATGAAGG + Intergenic
1038344711 8:26721615-26721637 TTCCATTTAATAATAGATGAAGG - Intergenic
1039993373 8:42509000-42509022 TCCCATTTTAAAAGTGATGAAGG - Intronic
1040657152 8:49524647-49524669 TCCCTTATAAAACTAGATGAAGG - Intergenic
1040752976 8:50733752-50733774 CTCCATTAAAAAATAGACGAAGG - Intronic
1041600292 8:59709371-59709393 TGGCATTTGAAGATAGCTGATGG - Intergenic
1042323014 8:67497954-67497976 TTAAATTTAAAAATAGAGGATGG - Intronic
1042719117 8:71807906-71807928 TTCCATTTAAAAACAAATTATGG + Intergenic
1043427991 8:80167476-80167498 TGCCACATAAAAATAAATGCAGG + Intronic
1045792351 8:105998526-105998548 TCACATTTAAAAATGGATAAAGG - Intergenic
1045881163 8:107042271-107042293 TGTCTTTTAAAAAAAGATGGGGG + Intergenic
1045906682 8:107354290-107354312 TGCCTTTTAAAAAAAGGTAAAGG - Intronic
1046210397 8:111065782-111065804 TTCCATTTAAAAATATGTAAAGG + Intergenic
1046272343 8:111913692-111913714 GGCCATTTAAAAATGGAAGGAGG - Intergenic
1046346441 8:112934281-112934303 TGCCATAAAAAAATAGATGCTGG - Intronic
1046731648 8:117732556-117732578 TGTTATTTAAAAATAAATAAAGG - Intergenic
1046947210 8:119985378-119985400 TCCCATTGAAAAGTAGGTGAGGG - Intronic
1047234146 8:123024353-123024375 TGCCATTTAAACTTGGCTGAGGG - Intronic
1047284773 8:123478613-123478635 TGACATTTAAGACCAGATGATGG + Intergenic
1048034248 8:130662109-130662131 TTCCATCTAAAAATTGAGGAGGG + Intergenic
1048326818 8:133446156-133446178 TGCCATTTTATATTAGTTGAAGG + Intergenic
1049026736 8:139996629-139996651 TGCCATTTTTAAATAAATAATGG + Intronic
1054900598 9:70364853-70364875 TGTCATTTAAAAAAAAAAGATGG - Intergenic
1055248831 9:74278131-74278153 TGTCCTTTTAAAAGAGATGATGG - Intergenic
1055459181 9:76501384-76501406 TGGAATTTGAATATAGATGAAGG + Intronic
1055484450 9:76743930-76743952 TGCAATTTAAAAACAGATAAAGG + Intronic
1056276618 9:84999978-85000000 TGCCATTTAAAAATTCAGGAAGG - Intronic
1056980002 9:91300880-91300902 TGCCATGTAAGCATAGAGGAAGG - Intronic
1057375329 9:94516555-94516577 TGTAATTTAAAAACAGGTGAAGG + Intergenic
1059017644 9:110537805-110537827 GGCCATTTAAAAATCAACGAGGG + Intronic
1059169542 9:112112304-112112326 TGTCATTTAAAAAGAGTGGATGG - Intronic
1059605553 9:115831088-115831110 AGCCATTTAAAAGGAGATGTGGG + Intergenic
1060710225 9:125855556-125855578 TGACATCTAAAATTTGATGAAGG - Intronic
1060856504 9:126917917-126917939 TGCCTTTGAAGAAAAGATGACGG - Intronic
1060960324 9:127676241-127676263 TGCAAGTTAAAAATACGTGATGG - Intronic
1062746182 9:138213424-138213446 TGCAATTTACCAAAAGATGAAGG + Intergenic
1185928688 X:4175697-4175719 TGCCATTTAAAAATGGGCAAAGG + Intergenic
1185945984 X:4376694-4376716 TGTCAATTAAAAATACATAAAGG - Intergenic
1186539571 X:10386741-10386763 TGAAATTTAAAGATAGATAAGGG + Intergenic
1187228194 X:17394469-17394491 TGCCTTTTAAAAACTGATGGAGG + Intronic
1187239939 X:17503121-17503143 TGTCATTTAAAAATTTATAAGGG - Intronic
1187469728 X:19558509-19558531 TGATATTTTAAAATGGATGATGG - Intronic
1187647568 X:21365177-21365199 TGAAATTTAAAAAAAGAAGATGG - Intergenic
1187872516 X:23776260-23776282 CACAATTTAAAAATGGATGAAGG + Intergenic
1188119673 X:26288441-26288463 TTCCATTGAAAAGTGGATGAAGG - Intergenic
1188930068 X:36098021-36098043 GGCTATTTAAAAATAGATAGAGG - Intronic
1190017363 X:46838441-46838463 TGCCATTTAAAGTTATCTGATGG + Intronic
1190164800 X:48064427-48064449 GGCCATTGAAAAACACATGATGG - Intronic
1190745384 X:53319371-53319393 TGCCATTTAAAAAGATACGGGGG + Intronic
1192595866 X:72407626-72407648 TGCAATTTGAAAATGGAGGAAGG + Intronic
1193013777 X:76708847-76708869 AACCATTGACAAATAGATGAAGG + Intergenic
1194190512 X:90830341-90830363 TGTCTTTTAAAAATAGATATTGG + Intergenic
1194496110 X:94619392-94619414 TGCCATTAAATAATACATCAAGG - Intergenic
1194969405 X:100326424-100326446 TTTCATTAAAAAATAAATGAGGG - Intronic
1195804619 X:108749744-108749766 TGCCACTTAAAGTTAGGTGAGGG + Intergenic
1197393695 X:125899039-125899061 TGCCTTTTAAAAATATCTCATGG - Intergenic
1197485076 X:127038885-127038907 TGCCCTTTGCAAATAGATGAGGG - Intergenic
1197605977 X:128585920-128585942 TTACATTTAAAACTAGATGATGG + Intergenic
1197899785 X:131358206-131358228 TGACATTTAAAAATATACTATGG + Intronic
1198298377 X:135309326-135309348 TGGCATTTCAAATCAGATGATGG + Intronic
1198307454 X:135397219-135397241 TGGCATTTCAAATCAGATGATGG + Intergenic
1198767903 X:140096982-140097004 TGCCTTTTATAAAATGATGATGG + Intergenic
1199509263 X:148602109-148602131 TGCCATTTAAAAAGAGAGCTTGG + Intronic
1200537171 Y:4412765-4412787 TGTCTTTTAAAAATAGATATTGG + Intergenic
1201315145 Y:12637389-12637411 TGTAATTTAAAAATGGATGAAGG - Intergenic