ID: 1150699294

View in Genome Browser
Species Human (GRCh38)
Location 17:67433704-67433726
Sequence TTATTTCTATTTTTTAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131940
Summary {0: 2, 1: 67, 2: 1183, 3: 6488, 4: 124200}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150699294_1150699296 -5 Left 1150699294 17:67433704-67433726 CCATCTCTAAAAAATAGAAATAA 0: 2
1: 67
2: 1183
3: 6488
4: 124200
Right 1150699296 17:67433722-67433744 AATAAGAAAAAGAGGAAGCCAGG 0: 1
1: 1
2: 12
3: 214
4: 2053
1150699294_1150699301 20 Left 1150699294 17:67433704-67433726 CCATCTCTAAAAAATAGAAATAA 0: 2
1: 67
2: 1183
3: 6488
4: 124200
Right 1150699301 17:67433747-67433769 CAGGCTCAGGAGGCTGACGCAGG 0: 1
1: 2
2: 46
3: 444
4: 7018
1150699294_1150699299 10 Left 1150699294 17:67433704-67433726 CCATCTCTAAAAAATAGAAATAA 0: 2
1: 67
2: 1183
3: 6488
4: 124200
Right 1150699299 17:67433737-67433759 AAGCCAGGTGCAGGCTCAGGAGG 0: 1
1: 0
2: 3
3: 33
4: 370
1150699294_1150699298 7 Left 1150699294 17:67433704-67433726 CCATCTCTAAAAAATAGAAATAA 0: 2
1: 67
2: 1183
3: 6488
4: 124200
Right 1150699298 17:67433734-67433756 AGGAAGCCAGGTGCAGGCTCAGG 0: 1
1: 1
2: 2
3: 37
4: 432
1150699294_1150699297 1 Left 1150699294 17:67433704-67433726 CCATCTCTAAAAAATAGAAATAA 0: 2
1: 67
2: 1183
3: 6488
4: 124200
Right 1150699297 17:67433728-67433750 AAAAAGAGGAAGCCAGGTGCAGG 0: 1
1: 1
2: 2
3: 45
4: 537
1150699294_1150699302 23 Left 1150699294 17:67433704-67433726 CCATCTCTAAAAAATAGAAATAA 0: 2
1: 67
2: 1183
3: 6488
4: 124200
Right 1150699302 17:67433750-67433772 GCTCAGGAGGCTGACGCAGGAGG 0: 3
1: 295
2: 6351
3: 14879
4: 36729

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150699294 Original CRISPR TTATTTCTATTTTTTAGAGA TGG (reversed) Intronic
Too many off-targets to display for this crispr