ID: 1150699301

View in Genome Browser
Species Human (GRCh38)
Location 17:67433747-67433769
Sequence CAGGCTCAGGAGGCTGACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7511
Summary {0: 1, 1: 2, 2: 46, 3: 444, 4: 7018}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150699294_1150699301 20 Left 1150699294 17:67433704-67433726 CCATCTCTAAAAAATAGAAATAA 0: 2
1: 67
2: 1183
3: 6488
4: 124200
Right 1150699301 17:67433747-67433769 CAGGCTCAGGAGGCTGACGCAGG 0: 1
1: 2
2: 46
3: 444
4: 7018

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150699301 Original CRISPR CAGGCTCAGGAGGCTGACGC AGG Intronic
Too many off-targets to display for this crispr